charite / q Goto Github PK
View Code? Open in Web Editor NEWQ ChIP-seq peak caller
Home Page: http://charite.github.io/Q/
License: Other
Q ChIP-seq peak caller
Home Page: http://charite.github.io/Q/
License: Other
Hi,
We've tried installing and running "Q" in two different Ubuntu systems,
and in both cases configure/make/makeinstall runs smoothly
but then when we try to run it with "-t afile.bam" and "-o somefolder" , we get the following error:
"
ERROR: Trying to open BAM file and ZLIB is not available!
ERROR: Could not open <MY_FILE_NAME>.bam !
ERROR: Function 'ReadAlignmentFile' failed !"
"
It looks like a problem with seqan but I don't know what I could do to fix it, any ideas?
First didn't complies, then installed libbz2. There is lib/libbz2.a and include/bzlib.h under /home/user/opt/libbz2/
./configure --prefix=/home/user/opt/Q-2015-v1 --libdir=/home/user/opt/libbz2/lib
then replace
LIBS = -lgomp -lbz2
with
LIBS = -lgomp -lbz2 -L/home/user/opt/libbz2/lib
make
make install
both complies
But
/home/user/opt/Q-2015-v1/Q --treatment-sample T.bam --control-sample INPUT.bam --out-prefix test -pc 6
will report
ERROR: Trying to open BAM file and ZLIB is not available!
ERROR: Could not open T.bam !
ERROR: Function 'ReadAlignmentFile' failed !
tried
make CFLAGS=-DSEQAN_HAS_ZLIB=1
or
add
to
src/seqan/core/include/seqan/stream.h
both complied success but reported same error
I seems have zlib that there are
libz.a libz.so libz.so.1 libz.so.1.2.5
under /home/user/opt/zlib-1.2.5/lib and /home/user/opt/zlib-1.2.5/lib is in my $LD_LIBRARY_PATH
Anything else I can try?
Thanks!
Hi:
Following the Q nexus manual, I created an adapter file, adapters.fa
, which looks like
adapter1
AGATCGGAAGAGCACACGTCTGGATCCACGACGCTCTTCC
adapter2
GATCGGAAGAGCACACGTCTGGATCCACGACGCTCTTCC
adapter3
ATCGGAAGAGCACACGTCTGGATCCACGACGCTCTTCC
adapter4
However, when I try to use this adapter file with flexcat, I get the following message:
End for adapter "adapter1" not specified, adapter will be ignored.
End for adapter "adapter2" not specified, adapter will be ignored.
End for adapter "adapter3" not specified, adapter will be ignored.
End for adapter "adapter4" not specified, adapter will be ignored.
I'm not understanding what format flexcat is expecting for the adapter file. Any feedback is very appreciated!
Hi,
Is it necessary for peak calling of histone modifications ChIP-seq data to remove the mapped reads on chrN_random, ChrUn and chrM before running Q?
Thank you!
H3K4me3 peaks in Mouse (mm10) or C.elegans (WBcel235) are identified by using Q v1.3.0 with default parameters (except for -wbt, -wbc), but there is a error for some samples, such as:
Although this error doesn't affect the results, but I guess that you want to figure it out in next version of Q.
BTW: my H3K4me3 ChIP-seq data is paired-end (by Illumina HiSeq X Ten) and sorted BAM files based on genomic positions are the values of --treatment-sample and --control-sample.
File 9-Q-run1-1.sh is available:
https://github.com/CTLife/TEMP/blob/master/peakCallerQ/9-Q-run1-1.sh
Hi!
congrats for the tool!!!!
I was trying to look information how to use it, but cannot find it inside github.
I tried to go to http://compbio.charite.de/Q/, but gives me 404 error.
It would be great some quick start here! willing to test it.
Though I can successfully execute Q on the BAM file suggested in the Tutorial (http://charite.github.io/Q/tutorial.html), the program crashes on my own BAM file. I'm on CentOS.
(DK)[dkelley@dkelley01 data]$ Q -p 4 -t foxa2_hepg2.bam -wbt -o foxa2_hepg2
*** glibc detected *** Q: double free or corruption (!prev): 0x000000000e2e4080 ***
======= Backtrace: =========
[0x4f83b2]
[0x4fae4f]
[0x431a02]
[0x424948]
[0x4ce0db]
[0x400449]
======= Memory map: ========
00400000-005c5000 r-xp 00000000 00:18 10795374991 /n/home03/dkelley/bin/Q
007c4000-007c7000 rw-p 001c4000 00:18 10795374991 /n/home03/dkelley/bin/Q
007c7000-007e3000 rw-p 00000000 00:00 0
019c9000-13753000 rw-p 00000000 00:00 0 [heap]
2adc35494000-2adc36495000 rw-p 00000000 00:00 0
2adc36495000-2adc36496000 ---p 00000000 00:00 0
2adc36496000-2adc36696000 rw-p 00000000 00:00 0
2adc36696000-2adc36697000 ---p 00000000 00:00 0
2adc36697000-2adc36897000 rw-p 00000000 00:00 0
2adc36897000-2adc36898000 ---p 00000000 00:00 0
2adc36898000-2adc36a98000 rw-p 00000000 00:00 0
2adc37496000-2adc39497000 rw-p 00000000 00:00 0
2adc3c000000-2adc3c10e000 rw-p 00000000 00:00 0
2adc3c10e000-2adc40000000 ---p 00000000 00:00 0
2adc44000000-2adc4411f000 rw-p 00000000 00:00 0
2adc4411f000-2adc48000000 ---p 00000000 00:00 0
2adc4c000000-2adc4f14d000 rw-p 00000000 00:00 0
2adc4f14d000-2adc50000000 ---p 00000000 00:00 0
2adc50000000-2adc55002000 rw-p 00000000 00:00 0
7fffcbc39000-7fffcbc52000 rw-p 00000000 00:00 0 [stack]
7fffcbe00000-7fffcbe01000 r-xp 00000000 00:00 0 [vdso]
ffffffffff600000-ffffffffff601000 r-xp 00000000 00:00 0 [vsyscall]
Aborted
The BAM file was obtained using the following command.
bowtie2 -U ENCFF000PIT.fastq.gz -x bowtie2/hg19 | samtools view -q 3 -bS - | samtools sort -T foxa2_hepg2_sort -O bam -o foxa2_hepg2.bam -
I'd be happy to send the BAM file if that would help. Thanks for any help you can provide!
Dear Q,
We are planning to use ChIP-Nexus and analyze Q-Nexus program.
Do we need to use control sample? I saw the psuedo-control in your publication.
Is it work with real control sample?
Regards,
Won
The readme file says that all of the boost dependencies are found in src/boost, but the folder
seems to be missing.
Could you please just tell which files are necessary?
Cheers!
Vedran Franke
Hi,
I ran Q on two data sets. For one of them I got results which may be reasonable (I need to look at the details) but for the other one (which is actually a much better quality data) I got no peaks at all. If I run Q with default options it estimates the average fragment length to be 1 (it prints 2^32+1) but even when I provided the average fragment length it still has not found a single peak (even though there are hundreds of very reliable ones). The original data was paired ends and I thought that this could have created the problem (even though I do not know why) so I kept only the first mate in every pair (and so the strand is random) but it did not help.
Any idea why this happens (and is there any way to avoid this)? I can upload my file (and control - it makes no difference).
Thank you in advance,
Moshe.
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.