Does TIF work well for non-LTRs ? about tif HOT 8 CLOSED

Hi,
Currently, TIF is not supported for non-LTR retrotransposons. If you know accession numbers of NGS containing sequences of jumped non-LTR retrotransposons, let me know accession numbers. I will add scripts for non-LTR retrotransposons.
Thank you for your comment,
Akio

from tif.

Thank you so much for responding.

Here are the accession numbers. They should all have insertions of non-LTRs.
DGRP.names.list.txt

The non-LTR we are interested in is Jockey-3. Here is the consensus sequence if that would help

jockey-3_DM_Consensus_06052020.txt

Thank you so much.

from tif.

Hi,

Initial version of tif_nonltr.pl is now registered.

Usage is
perl tif_nonltr.pl SRR834538 dmel626.fasta GAACCCTCTGTCGTAGAACACTACTA

I attempted to detect the transposition from some accessions of your list.
But I can not detect transposition. If you know accession with transposition of jockey-3, try the accession first.

Akio

from tif.

Hello thank you so much. I have reran the program on accession numbers and I got output written in the result. like that for example

Does this indicate the insertion site in the reference genome ? what is the difference between labaling head and tail ?

I did check at the coordinates within a window and it looks similar to TSD we see

Thank you so much

from tif.

Hi,

Because downstream flanking sequence of non-LTR-retrotransposons may have unclear TSD, tif_nonltr.pl detect junction within 100bp distance between junctions of head and polyA tail of the retrotransposon. The transposon may be inserted in the Y_Contig26.

Akio

from tif.

oh thank you so much for all the help, so can i interpret that between these coordinates a might be a possible target insertion ?

from tif.

Yes, may be.

If fragment is obtained by PCR with primers between the target region and the transposon, the transposon should be inserted at the target region.

Akio

from tif.

Thank you so much for all the help. I really appreciate it. This helped us.

from tif.