stri_*_fixed: add an option to take into account overlapping pattern matches about stringi HOT 6 CLOSED

BTW, playing with that using positive look-aheads:

stri_locate_all_regex("ACAGAGACTTTAGATAGAGAAGA", "(?=AGA)")

from stringi.

When done, reply in this SO question :)
http://stackoverflow.com/questions/26600735/matching-and-counting-strings-k-mer-of-dna-in-r

from stringi.

Work ongoing:

> stri_count_fixed("AAAAA",c("A","AA","AAA"),rep(0:1,each=3))
[1] 5 2 1 5 4 3
> stri_count_fixed("AAA","AA",overlap=c(T,F))
[1] 2 1

from stringi.

BTW, for *_coll this'll be very easy (I'll take care of it when stringi 0.3 will be on CRAN): we have USEARCH_OVERLAP with options USEARCH_OFF and USEARCH_ON; UStringSearch has a usearch_setAttribute function

from stringi.

A list of functions that need the overlap arg:

• count
• locate_all
• extract_all

Don't need:

• detect
• startswith, endswith
• subset
• extract_first, extract_last
• locate_first, locate_last
• split
• replace
• split

from stringi.

if stri_opts_fixed will be introduced, put this option here ===> depends on #110

from stringi.