Giter VIP home page Giter VIP logo

Comments (1)

rpetrovski avatar rpetrovski commented on July 23, 2024

The example data seems to have been built with iSAAC-01. Both iSAAC-01 and iSAAC-02 are not being supported anymore. Please let me know if the issue still exists with iSAAC-03

Roman.

$ samtools view bam/problem.bam -H |grep VN
@hd VN:1.0 SO:coordinate
@pg ID:iSAAC PN:iSAAC CL:/opt/illumina/Isis/2.5.26.13/Workflows/ResequencingWorker/isaac-align -t /home/ec2-user/compute/scratch/isaacTemp -o /home/ec2-user/compute/344404/isaac_align/Alignment -r /opt/genomes/Homo_sapiens/UCSC/hg38-hli/Sequence/IsaacIndex/sorted-reference.xml --base-calls HLVMVCCXX -s HLVMVCCXX/SampleSheetNew.csv --ignore-missing-filters 1 --base-quality-cutoff 15 --use-bases-mask Y150N1,Y150N1 --default-adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA_,_TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT --variable-read-length yes --barcode-mismatches 1 --ignore-missing-bcls 1 --stop-at Finish --allow-empty-flowcell 1 --seed-length 32 --cleanup-intermediary 1 --verbosity 3 --start-from Start --lane-number-max 8 --memory-limit 56 --base-calls-format fastq-gz --stats-image-format none --per-tile-tls 1 VN:iSAAC-01.14.02.06

from isaac2.

Related Issues (14)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.