Assembling failed about getorganelle HOT 8 CLOSED

Can you show me the intact log file?
As you said, filtred paired reads files were empty. So it could be the problem with reads extending. I need your intact log to help you.
By the way, you had 10G raw data, that's really too much and unnecessary. But this is another thing and should not be the reason for the failure.

from getorganelle.

below the content of log file:

GetOrganelle v1.0.3a

This pipeline get organelle reads and genomes from genome skimming data by extending.
Find updates in https://github.com/Kinggerm/GetOrganelle and see README.md for more information.

/home1/software/GetOrganelle/get_organelle_reads.py -1 /sanhome2/trimmed/out2045_1.clean.fastq -2 /sanhome2/trimmed/out2045_2.clean.fastq -s pc_ref.fa -w 103 -J 3 -M 5 -o chloro_out -R 5 -k 75,85,95,105 -P 1000000

2018-07-20 12:16:20,997 - INFO: Unzipping reads ...
2018-07-20 12:16:20,997 - INFO: Unzipping reads finished.

2018-07-20 12:16:20,998 - INFO: Reading seeds ...
2018-07-20 12:16:20,998 - INFO: Making seed - bowtie2 index ...
2018-07-20 12:16:21,195 - INFO: Making seed - bowtie2 index finished.
2018-07-20 12:16:21,195 - INFO: Mapping reads to seed - bowtie2 index ...
2018-07-20 12:42:44,225 - INFO: Mapping finished.
2018-07-20 12:42:44,225 - INFO: Reading seeds finished.

2018-07-20 12:42:44,226 - INFO: Pre-reading fastq ...
2018-07-20 13:01:24,167 - INFO: 133898628 candidates in all 154713318 reads
2018-07-20 13:01:24,629 - INFO: Pre-reading fastq finished.

2018-07-20 13:01:24,630 - INFO: Pre-grouping reads...
2018-07-20 13:01:38,120 - INFO: 1000000/9475444 used/duplicated
2018-07-20 13:05:27,871 - INFO: 53791 groups made.

2018-07-20 13:05:56,287 - INFO: Adding initial words ...
2018-07-20 13:16:32,772 - INFO: Adding initial words finished.

2018-07-20 13:16:32,773 - INFO: Extending ...
2018-07-20 13:36:12,155 - INFO: Round 1: 133898628/133898628 AI 20604128 AW 331308344
2018-07-20 14:11:32,280 - INFO: Round 2: 133898628/133898628 AI 30262507 AW 431633632
2018-07-20 14:32:01,445 - INFO: Round 3: 133898628/133898628 AI 37325034 AW 507733592
2018-07-20 14:53:01,108 - INFO: Round 4: 133898628/133898628 AI 42667564 AW 566007848
2018-07-20 15:14:54,873 - INFO: Round 5: 133898628/133898628 AI 46775908 AW 611042474
2018-07-20 15:14:54,875 - INFO: Hit the round limit 5 and terminated ...
2018-07-20 17:46:45,566 - INFO: Extending finished.

2018-07-20 17:46:45,567 - INFO: Separating filtered fastq file ...
2018-07-20 17:50:45,343 - INFO: Separating filtered fastq file finished!
2018-07-20 17:50:47,679 - INFO: Assembling using SPAdes ...
2018-07-20 17:50:48,293 - ERROR: Error in SPAdes:
== Error == system call for: "['/home1/software/SPAdes-3.11.1-linux/bin/hammer', '/sanhome2/Organnelle/chloro_out/filtered_spades/corrected/configs/config.info']" finished abnormally, err code: 255

2018-07-20 17:50:48,298 - ERROR: Assembling failed.

Total Calc-cost 20067.3784549
Thanks you!

from getorganelle.

Sorry for the trouble and thanks a lot for the information!
As I can tell from the log file, the extending is normal. But you mentioned that "filtred paired reads files were empty", can you show me a few reads you have for both out2045_1.clean.fastq and out2045_2.clean.fastq by

head -n 8 /sanhome2/trimmed/out2045_1.clean.fastq
head -n 8 /sanhome2/trimmed/out2045_2.clean.fastq

I want to make sure whether it was the problem with the format detecting.

from getorganelle.

head -n 8 /sanhome2/trimmed/out2045_1.clean.fastq:

@SRR6062045.201.1 201 length=151
TGGAGAACAAAGGATTTTATGTGCCAGTGGTGATCCTTTTTCAAATCTTGCTTTCTTCTAACTCTGGTTATTGCTTTTGTAGTGGTGGTGAGGTGCTCTGTGATTTTGTACTTCTAACTCTTCTTTCTCGTCTGTATGTGCACGTACAA
+
AFFJJJJJJJJJJAJJ7-FFJFJJJAFJAJ-<--<J<FAFAJFJJJFJJJFAF-FJJJF<FAAFFJJA-JA777<<AF<77A7<JF7JFJFAAFJFJ<F-<7A-FJFJFFJAJFAAFFAFJ7AJJ7FAFJ7AAJJ7A-<7<<FF<FJJF
@SRR6062045.202.1 202 length=151
TGCTTAAAGTTCATTCAAATTACAAAAATTAATTTAAGAAATTATGTAAAAATATCTACACAAAAATTAATTTCTTTCCCCTTTTTTTGTTTTTTAAACTAAACTAACCCTAAATTAACTTGTGCATACTGTCATCTGGAGCAAAAAAG
+
AFFJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJFJJ7FFJ<FJJJJJ<JJFJJJJFFFAJJ-AAFJJ<FJJJJFFFJJJ-<AJJJJJJA

head -n 8 /sanhome2/trimmed/out2045_2.clean.fastq:
@SRR6062045.201.2 201 length=151
AGGAAGCAATAGATCTCTCTCTCAACGACAAGAGAGTGCTCCCTTCCCCTTCTACTTTACAAAAACCGTGAAACGTAAGCATCTGCAAACCACAAATCTACCCCCTGAATTGAAATCAAAATTAAAAGACTAGTTGTACGTGCACATACAG
+
AAFFFJJJJJJ7JFJ<FJFAF-FJJJFJA<AAJFFF7FFJFJJJJAJJJJFJFFJJFJFJJJJJJJFF-AFJJJJJJJFAJAFFFJAJF<FJJFA-<FAJFF7FFAJJAAAFFJF-7<FJAF-<<-<777<<7<F7<<---<-A7F<F7F-
@SRR6062045.202.2 202 length=151
GGTGGGTTCCTTGTGGCAACCGGTCAATGCCAACCCCCTTGGTGGGGCCGCTGGCTTCCTGATTTACCTCTCACACGATGCTCGTGGGGCCGGGTGGTGTGGGCCGGTTAGGGTGTCCGGACAATACACCTTTTTTGCTCCAGATGACAGT
+
A-FFFJJJJJJJJJJFJJJJJJJJFJJJJJJJJJJJJJF<FJFJJJJJJJJJJJJ<JJJJJJJJJJJJJJFJJFJJJJJJJ-FJ<<JFJJJJJJ-7AAJFJJFFJJJAJAJJJ7J<AJJJFJF7-<-<<AA<<FJJ-A-7<FJ<FF-A-A-

from getorganelle.

Thanks!
Now I see the problem. The head is not compatible with this GetOrganelle version.
I am going to fix this latter for your type of data. I would let you know once done. It would be quick.

from getorganelle.

Thank you very much!

from getorganelle.

Hi, I made a few changes so that it could works for a small testing data. You could easily using git pull to update GetOrganelle.
Let me know if you could go through your data with new version. Also, I strongly suggest you reduce your dataset to 2G per end for plastome assembly. 2G is really enough and much more faster.

from getorganelle.

Hi thank you for your help, the issue is solved!

from getorganelle.