Comments (9)
After the alignment ARCS returns me this error
###### Fri 30 Nov 15:35:27 GMT 2018: Running ARCS
Running: arcs 1.0.5
pid 161016
-c 5
-d 0
-e 30000
-l 0
-m 50-10000
-r 0.05
-s 98
-v 0
-z 500
--gap=100
-b ID1090_1_renamed_bcfrac066_pseudohap_1kb.fasta.scaff_s98_c5_l0_d0_e30000_r0.05
-g ID1090_1_renamed_bcfrac066_pseudohap_1kb.fasta.scaff_s98_c5_l0_d0_e30000_r0.05.dist.gv
--barcode-counts=NA
--tsv=NA
-a Pdid.LinkedReads.Aligned.sortedByCoord.out.bam
-f ID1090_1_renamed_bcfrac066_pseudohap_1kb.fasta
=> Getting scaffold sizes... Fri Nov 30 15:35:27 2018
=> Reading alignment files... Fri Nov 30 15:35:28 2018
error: `@SQ SN:bcfrac066.1 LN:1327': No such file or directory
from arcs.
Hi @francicco,
The input fastq files can be either in the format you show above, or the barcode can also be in a comment of the read header (@Name BX:Z:barcode
). So, you can just use the reads generated by longranger basic. If you keep the barcode in the BX comment, you just need to add the -C
option to the bwa mem
command so that the barcode will be placed in the BX tag of the SAM entries.
@NB501445:179:H2YG7BGX7:2:11312:9490:14604 BX:Z:AAAAAAAAAGCAATTT-1
AAATTAAGTGATATATCCTCTTACGAAGTTGTTTCGGTTTAAAATTATTGTTATTATTTTTTAATGATGTGCAGAAAGTAAAGCAACATGAAGCTTTATTTACTACCAACTTCATTTCCCTTCAATA
+
EEEEEEEEEEEEEEEEEEEEEEEEEE6EEEEEEEEAE<AEA/A/EE/EEAA</EE/EEEEEEE/EEEEEEE//<EE/EEEEEEEEEEEEEE/EAEAEEEAEE<EAE<</<EAEEAEEE</A/E</EE
@NB501445:179:H2YG7BGX7:3:21602:1860:16340 BX:Z:AAAAAAAAATTATAAA-1
AAAAAAATGTTACCCACAATCCCATGATTTGCCATGCATGTATATAGGGACATATCCAATGATAGACATCGCGTTGTTACCGCGTCAACGGGGCTCTAGTAAGAATAAATTCGCAGTCACAGCTTTG
+
EEEEEEEEE/EE//E/E/E//6A/EE/A</EEAEEEE/E/<E/EEE<///EE//A/EE/EE/AEEEEEAAE6/EE/EA//EEEEEE<EEA</EE/</EE//AEE//<E/EA<AEA</E/AA/E/E/A
You can also leave the input read files interleaved if you wish (default of longranger basic), and would just need to add -p
to the bwa mem
command to make sure the reads are paired properly.
As for the error, the input file to -a
is expected to be a text file listing the path to all the alignment files you wish to use. It looks like you supplied the BAM file itself.
-a, --fofName=FILE text file listing input SAM/BAM filenames
As a side note we do have a Makefile (Examples/arcs-make) which runs the whole ARCS pipeline, taking the reads and the draft assembly as input. Even if you don't want to use the Makefile, I'd recommend taking a look to get an idea of the required steps.
Hope that helps!
Lauren
from arcs.
Hi @lcoombe,
Sorry, I was a bit lat with the test. I'm still playing around with some tests to check the pipeline.
Now I'm mapping the interlaced reads with BWA.
[M::process] 2819384 single-end sequences; 0 paired-end sequences
It looks like BWA doesn't recognise the paired ends with are formatted like this
@D00352:465:CD1CHANXX:2:2209:5496:86527/1_AAAAAAAAAAATGAAC
TAAGTCAACTAATCAACTAGATTCTCAGGTTCCCTCTGCCTACCCTGCTATGTGCGGTATACAGCGTGAAGCTAAAAAAAGCCAACTTATCAACTATGTCGT
+
BB<BF//</<B/<FFF/BB<FF/<F/B</B/FFFB///<<F/B<B/</<7/7F<FF7/B7BBFBF7FFFF<<<///7<F///////////BB77/////7/7
@D00352:465:CD1CHANXX:2:2209:5496:86527/2_AAAAAAAAAAATGAAC
CTAAATATGTTTTTTGTTTCCTAAGTGTGTGATTAGCACTTTAAAACTTCAAAAAAGATTTTTTTATGCGTAAAAAAGCACGATGTTAAATTCTGGGATTCAACACGTACCTAATATCTTAAATT
+
/BBB//FFBBBFFF/F<<FFBB/<FBFB/F/<FFFF</<FF<F<<<FFBF<FFF//7F<<FFFFF////<//</<BFB<//F//F/<BFFFFFF/7/<FB/77/7/7<B/BBF<FFFF<<FBBFF
It that normal?
F
from arcs.
Hi @francicco - Could you post your most recent bwa mem
command? Are you using the -p
parameter?
from arcs.
That's the command
bwa mem -t$THREADS $SPECIES.fa -p $ARCSR.fastq.gz | samtools view -Sb - | samtools sort -@ $THREADS -n - > $SPECIES.LinkedReads.Aligned.sortedByCoord.out.bam
from arcs.
It is actually sorted by read. I just named it wrong.
F
from arcs.
@francicco - I believe it is due to the \1
and \2
suffixes that you added to the read header before appending the barcode sequence. I did a small test case, and this interfered with bwa mem
's smart pairing (-p
).
I suggest either going back to your original post-longranger fastq file (formatted as I showed in my initial comment) or removing those characters from the read headers so that the 2 read headers of a read pair are identical.
$ head -n8 lr.arcsformat.fq
@gi|453231901|ref|NC_003280.10|_12670490_12670606_0_1_0_0_0:0:0_0:0:0_5db95_AAACACCTCAGGCTGC
GAAAAGTTTCGTGTACTCCACACGGACACATACATTTAGTTTTAAAACTAAAATCAAGCCGCGACGCGACACGCAACGCGCCGTAAATCTACCCCAGATATGGCCGAGCAAAAATGGCCTAGTTCGGC
+
GFIEHGEFEDEGCEDBCCDB@CE=HBABBCABBADABBBB@@B>BACAA@<@AACCB?D@A@@@A@@??><BC??>?<A<B??A?><>==A;=??;B@==AB>>?=?>>=?><>;;@=<;=?>=>=?=
@gi|453231901|ref|NC_003280.10|_12670490_12670606_0_1_0_0_0:0:0_0:0:0_5db95_AAACACCTCAGGCTGC
CACTGTGCTTCACCACTTCATCACCCGCCGATTCTTTTGAAAAAAAAAATTTCTCACATACACATATATTGAGAGTAAAAGTCACAAGCCACGGATTTCTGGCTTCTCTCATAAATTGAAATGGAAGAGTTTGCCGAACTAGGCCATTTTT
+
GIHIIHGICFIHFEIIDCEDDDCEEEDDDCCEEACFBBBBECDBECCBAAAA>@ABAA@ABAAA@A?BB<B@@@D@@E>A??=?@?@B>@?>B>@>??>CB=A>A@?>=<A<>>?>>>B>>BA>>>>>@<?=>====?<==>?<====;?=
$ bwa mem -p /projects/btl_scratch/lcoombe/barcode-assemblies/unitig-graph/celegans/LRSIM-noVariantData/data/celegansN2_referencegenome.fna lr.arcsformat.fq > test.sam
[M::bwa_idx_load_from_disk] read 0 ALT contigs
[M::process] read 25 sequences (3476 bp)...
[M::process] 1 single-end sequences; 24 paired-end sequences
...
$ head -8 lr.arcsformat.subscr.fq
@gi|453231901|ref|NC_003280.10|_12670490_12670606_0_1_0_0_0:0:0_0:0:0_5db95/1_AAACACCTCAGGCTGC
GAAAAGTTTCGTGTACTCCACACGGACACATACATTTAGTTTTAAAACTAAAATCAAGCCGCGACGCGACACGCAACGCGCCGTAAATCTACCCCAGATATGGCCGAGCAAAAATGGCCTAGTTCGGC
+
GFIEHGEFEDEGCEDBCCDB@CE=HBABBCABBADABBBB@@B>BACAA@<@AACCB?D@A@@@A@@??><BC??>?<A<B??A?><>==A;=??;B@==AB>>?=?>>=?><>;;@=<;=?>=>=?=
@gi|453231901|ref|NC_003280.10|_12670490_12670606_0_1_0_0_0:0:0_0:0:0_5db95/2_AAACACCTCAGGCTGC
CACTGTGCTTCACCACTTCATCACCCGCCGATTCTTTTGAAAAAAAAAATTTCTCACATACACATATATTGAGAGTAAAAGTCACAAGCCACGGATTTCTGGCTTCTCTCATAAATTGAAATGGAAGAGTTTGCCGAACTAGGCCATTTTT
+
GIHIIHGICFIHFEIIDCEDDDCEEEDDDCCEEACFBBBBECDBECCBAAAA>@ABAA@ABAAA@A?BB<B@@@D@@E>A??=?@?@B>@?>B>@>??>CB=A>A@?>=<A<>>?>>>B>>BA>>>>>@<?=>====?<==>?<====;?=
$ bwa mem -p /projects/btl_scratch/lcoombe/barcode-assemblies/unitig-graph/celegans/LRSIM-noVariantData/data/celegansN2_referencegenome.fna lr.arcsformat.subscr.fq > test.sam
[M::bwa_idx_load_from_disk] read 0 ALT contigs
[M::process] read 25 sequences (3476 bp)...
[M::process] 25 single-end sequences; 0 paired-end sequences
...
Also, you are right that if bwa mem
doesn't do proper paired-end alignments that this will interfere with ARCS -- one of the filters that ARCS uses when reading the input BAM(s) is checking that read pairs are mapping in a proper pair.
from arcs.
Ok, thanks! I'll try to remove them from the header!
Thanks.
F
from arcs.
Sounds good - I'll close this, but feel free to re-open or open another issue if you have any other questions.
Thank you for your interest in ARCS!
Lauren
from arcs.
Related Issues (20)
- About Running ARCS in default mode HOT 3
- GCC version update HOT 1
- arcs-1.2.2: abyss-fixmate-ssq sometimes segfaults HOT 9
- Short read length question: can the tool accept 250? HOT 2
- arcs-long: tiny PE-pairs are produced HOT 3
- Scaffolding Expectations HOT 12
- Running ARCS and ARKS HOT 2
- Parameters for corrected ONT reads HOT 2
- arcs-make in bin HOT 2
- Add optional dependency of pigz HOT 1
- unrecognized option '--fastq' HOT 3
- fastq formatting barcodes in BX tag HOT 8
- ARKS fails to create any links with a highly repetitive input HOT 4
- Parameters for PacBio HiFi data HOT 3
- Can this software use HiC data, or need to use the sequencing technology mentioned in your paper? HOT 1
- `arcs-tigmint` and `arks-tigmint` struggle with input files outside working directory HOT 3
- Incorrect program call? HOT 6
- `arcs-long`/`arks-long` vs `LINKS`? HOT 2
- Understanding specific scaffolding output HOT 4
- tigmint-make 'missing separator' error HOT 8
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from arcs.