Comments (7)
@lcoombe I tried several parameters. For my dataset, increasing e to 9000 has the largest effect on N50, when a is between 0.7 and 0.9. Thank you very much for your help in getting my error sorted out! I am closing this ticket.
from arcs.
Hi @chen42,
Have you been able to successfully run the test example (Examples/arcs_test-demo)?
Could you provide all of the commands that were run when you used the arcs-make
Makefile?
Does your tigpair_checkpoint.tsv
file have pairs of contigs listed? (Feel free to include a few lines of the file here if you aren't sure)
from arcs.
Hi, @lcoombe,
Thank you very much for looking into my problem!
- I installed arc in my homedir on a cluster. There is not enough diskspace in my home to run the test. So I copied the Example scripts to a project directory and ran the
runARCSdemo.sh
command and it did finish and produced the scaffold.fa file. I just checked the error log and found the following message:
Traceback (most recent call last):
File "./makeTSVfile.py", line 96, in <module>
readGraphFile(infile)
File "./makeTSVfile.py", line 15, in readGraphFile
with open(infile, 'r') as f:
FileNotFoundError: [Errno 2] No such file or directory: 'hsapiens-8reformat.fa.scaff_s98_c5_l0_d0_e30000_r0.05_original.gv'
The tigpair_checkpoint.tsv
file is empty.
- For my own data, my arcs-make script is very simple:
cd /lustre/haven/proj/UTHSC0013/tigmint_data/arcs/
./arcs-make arcs draft=rn6_after_tigment reads=bnmale_barcode t=80
- here are several lines of my tigpair_checkpoint.tsv:
10 r1021 r1661 1 100
10 f1661 f1021 1 100
10 r1021 r3226 1 100
10 f3226 f1021 1 100
10 f1025 f1037 1 100
10 r1037 r1025 1 100
10 f103 r1823 1 100
10 f1823 r103 1 100
10 f1057 f959 1 100
10 r959 r1057 1 100
....
....
10 r931 f935 1 100
10 r935 f931 1 100
10 r9495 r9536 1 100
10 f9536 f9495 1 100
10 f953 r955 1 100
10 f955 r953 1 100
10 f981 f989 1 100
10 r989 r981 1 100
Thanks!
from arcs.
Thanks @chen42,
For your own run, the fact that the tigpair checkpoint file isn't empty is a good sign - that means that some connections are being made, although the ones that you are showing aren't very supported - only 1 barcode supports each of those links. Are all the values in column 4 of your tigpair_checkpoint tsv 1
?
Can you also post a few lines of your reads file, to just be doubly sure that the read headers are formatted correctly?
from arcs.
@lcoombe: I found the problem. My reads.fq.gz file was corrupted. So when I checked the file with zcat
, the first few lines were OK but there were not many reads in the file. The result is much better after fixing that issue, although most values in col 4 of the tigpair_checkpoint.tsv is still 1
:
$ cut -f 4 rn6_after_tigment_c5_m50-10000_s98_r0.05_e30000_z500.tigpair_checkpoint.tsv |sort |uniq -c |sort -rn |head
54662 1
398 2
208 3
174 4
168 6
168 5
154 7
150 8
140 10
134 9
Trying with a more accurate range for m
:
$ cut -f 4 rn6_after_tigment_c5_m50-3000_s98_r0.05_e30000_z500.tigpair_checkpoint.tsv |sort |uniq -c |sort -rn |head
54344 1
398 2
208 3
178 4
168 6
164 5
154 7
150 8
146 10
132 9
I assume the value of a
does not affect this. Any suggestion on which parameter I should try next? Thank you!
from arcs.
I forgot to provide the first few lines of my reads file:
@E00247:397:HJ7YLALXX:8:1101:12195:19768_AAACACCAGCGATATA
TATACCACACACACACACCCCACACCATACCACACATATACCGCACAAACACACACCCCCCCCCCCATCCCGCACCGCTATCCCATATGCCCACCCCTGCCCGCCACTCATCCCCCGACCACACTTCA
+
FJJJJFAFFJJFJJ<J<JJJJJJJJJ<JJFFFFJJJFJJFAJ--A7---<FJ-<-7----7---7--77-7-A7------7A-A-77--------)7)))))))-)))7----7))))-))7------
@E00247:397:HJ7YLALXX:8:1101:12195:19768_AAACACCAGCGATATA
ATGTGTGGTATGGTGTGGGGTGTGTGTGTGTGGGATACTCGCAGTATATCGCTGGTGTTGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAGTAAGTGAGAGGTGGTGGGTGGTTGCGG
+
AAFAFJJJJJJJJJJJJJFJJJJJJJJJJJJJA--<A-<-----7<7-AAFA-7F7A---7777-<A-7F<F-7--AAAFFFJF-A7F-F<AA-A-<<JAFJ<AJ<)<-)A))----7--7-7----------77-)77)7-)))7--))7
@E00247:397:HJ7YLALXX:8:1101:2798:21456_AAACACCAGCGATATA
CCCACACACACACACAACACACAACACACACACACACAGGCACATACACACACACAACACACAGACACAACACACACAACACACACATACACCCACCACACACACACACAGCACACACAACACCCCCC
+
JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJFJJJJJ<JJJJJJFJJJFJJFJJJ-77FAJ<FJAJ-A7A7AJAAAF-F<-<F<AJFFFJ)FAF<FFJAJ<F--7<J7<-A--A-A-7--)
from arcs.
@chen42 - Glad to hear you worked out the issues!
from arcs.
Related Issues (20)
- About Running ARCS in default mode HOT 3
- GCC version update HOT 1
- arcs-1.2.2: abyss-fixmate-ssq sometimes segfaults HOT 9
- Short read length question: can the tool accept 250? HOT 2
- arcs-long: tiny PE-pairs are produced HOT 3
- Scaffolding Expectations HOT 12
- Running ARCS and ARKS HOT 2
- Parameters for corrected ONT reads HOT 2
- arcs-make in bin HOT 2
- Add optional dependency of pigz HOT 1
- unrecognized option '--fastq' HOT 3
- fastq formatting barcodes in BX tag HOT 8
- ARKS fails to create any links with a highly repetitive input HOT 4
- Parameters for PacBio HiFi data HOT 3
- Can this software use HiC data, or need to use the sequencing technology mentioned in your paper? HOT 1
- `arcs-tigmint` and `arks-tigmint` struggle with input files outside working directory HOT 3
- Incorrect program call? HOT 6
- `arcs-long`/`arks-long` vs `LINKS`? HOT 2
- Understanding specific scaffolding output HOT 4
- tigmint-make 'missing separator' error HOT 8
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from arcs.