Hi

I get the following error message when i try to filter out the primers of my PacBio Reads when i execute the loop:
(Error in sapply(match.fwd, end) + 1 :
non-numeric argument to binary operator)

I am currently using the following script:

#setting the path and assign the files to list
path <- "~/OneDrive - Syddansk Universitet/HzsA/packed/"
list.files(path)
fns <- list.files(path, pattern="fastq.gz", full.names=TRUE)

#assign primers
FWD <- "GAGCACGTAGGTGGGTTTGT"
REV <- "AAAACCCCTCTACTTAGTGCCC"

rc <- dada2:::rc

nops <- file.path(path, "noprimers", basename(fns))
for(i in seq_along(fns)) {
fn <- fns[[i]]; nop <- nops[[i]]
dada2:::removePrimers(fn, nop, primer.fwd=FWD, primer.rev=dada2:::rc(REV), orient=TRUE)
}

Do you have any idea what is causing the error?

cheers and thanks for the splendid support you provide,

Clemens

Hello,
I am wondering if you could help me with the SRA accession to get the data files.
Thanks,

As shown in the page: DADA2 + PacBio: S. aureus from Wagner et al. 2016, there is an example data. How to download it?

fn <- file.path(path, "m150206_s1_p0_1_ccs_minpass_2_minprdaccry_99.fastq.gz")

Hello Dr. Benjamin,

I am having an issue while removing primers. The code is used for a set of data and I am using the same code for another set of data of the same nature. I ran into similar issues some had earlier in 2019 on your page and the problem there was wrong primers. But here, for my case, the primers were not removed with other tools and the code worked for some data of the same nature.

setwd("/Users/kishanmahmud/Desktop/Soil Microbiome Data/Non Toxic Endo")

path1 <- "ntcbind"
path2 <- "ntcbind"
path.out <- "Figures/"
path.rds <- "RDS/"
fns1 <- list.files(path1, pattern="fastq.gz", full.names=TRUE)
fns2 <- list.files(path2, pattern="fastq.gz", full.names=TRUE)
F27 <- "AGRGTTYGATYMTGGCTCAG"
R1492 <- "RGYTACCTTGTTACGACTT"
rc <- dada2:::rc
theme_set(theme_bw())
nops2 <- file.path(path2, "noprimers", basename(fns1))
prim2 <- removePrimers(fns1, nops2, primer.fwd=F27, primer.rev=dada2:::rc(R1492), orient=TRUE)

It is giving me a nopimers folder with fastq.gz files but also giving me this message.
"Error in sapply(match.fwd, end) + 1 :
non-numeric argument to binary operator"

Your help is requested. Thanks.

Best
Kishan

Hi! I am trying to run the code below line 138. In theory reading the st2 and tax2 RDS should be enough, but in line 154 sample.names2 is needed and it is not in the environment. Since the initial raw files are not available yet I am stuck in this spot. Thanks

Hi benjjneb,

I've downloaded the fastq.gz from NCBI pertaining to zymo_CCS_99.9.fastq.gz (SRR9089357), and going through the LRASms_Zyme.Rmd and i'm hung up on line ~92, err <- learnErrors(drp, BAND_SIZE=32, multithread=TRUE, errorEstimationFunction=dada2:::PacBioErrfun)

The output is: Error in getErrors(err, enforce = TRUE) : Error matrix is NULL.

the dada2 version is 1.30.0

I'm comparing the my running Rmd to your github LRASms_Zymo.html and I'm noticing some differences:

track <- fastqFilter(nop, filt, minQ=3, minLen=1000, maxLen=1600, maxN=0, rm.phix=FALSE, maxEE=2, verbose=TRUE)
Warning: '.\Zymo\noprimers\filtered' already existsOverwriting file:./Zymo//noprimers/filtered/zymo_CCS_99_9.fastq.gz
Read in 73057, output 72940 (99.8%) filtered sequences.

drp <- derepFastq(filt, verbose=TRUE)
Dereplicating sequence entries in Fastq file: ./Zymo//noprimers/filtered/zymo_CCS_99_9.fastq.gz
Encountered 22309 unique sequences from 72940 total sequences read.

err <- learnErrors(drp, BAND_SIZE=32, multithread=TRUE, errorEstimationFunction=dada2:::PacBioErrfun)
Error in getErrors(err, enforce = TRUE) : Error matrix is NULL.

I do not know if higher output reads 72940 (99.8%) vs 69367(94.9%) has anything to do with the ultimate learnErrors() error.

I had a similar situation running the LRASms_fecal.Rmd as well.

thank you for your time,
Mark