bimberlab / discvrseq Goto Github PK

Hi there

The flu reference genome makes use of IUPAC ambiguous bases (e.g. R). Calling variants results in things like R -> A variants being called, due to the variant caller not supporting IUPAC ambiguous bases. These variants can be ignored, and they don't trigger any failure of the variant caller. However, VariantQC terminates with an error when it finds variants like this. Would it be possible to handle such variants so that VariantQC does not terminate?

Thanks
Roberto

Hi,

I think this is a known issue, but I do not find an issue page for it.
I recently updated my java to run other apps and it does not run your tool and dies with:

$ java ${javaopts} -jar $BIOTOOLS/DISCVRSeq/DISCVRseq.jar VariantQC --help

WARNING: sun.reflect.Reflection.getCallerClass is not supported. This will impact performance.
Exception in thread "main" java.lang.ExceptionInInitializerError
        at org.broadinstitute.hellbender.Main.extractCommandLineProgram(Main.java:304)
        at org.broadinstitute.hellbender.Main.setupConfigAndExtractProgram(Main.java:180)
        at org.broadinstitute.hellbender.Main.mainEntry(Main.java:202)
        at com.github.discvrseq.Main.main(Main.java:50)
Caused by: java.lang.UnsupportedOperationException: No class provided, and an appropriate one cannot be found.
        at org.apache.logging.log4j.LogManager.callerClass(LogManager.java:573)
        at org.apache.logging.log4j.LogManager.getLogger(LogManager.java:598)
        at org.apache.logging.log4j.LogManager.getLogger(LogManager.java:585)
        at org.broadinstitute.barclay.argparser.ClassFinder.<clinit>(ClassFinder.java:29)
        ... 4 more

$ java --version

openjdk 17.0.6 2023-01-17
OpenJDK Runtime Environment (build 17.0.6+10-Ubuntu-0ubuntu120.04.1)
OpenJDK 64-Bit Server VM (build 17.0.6+10-Ubuntu-0ubuntu120.04.1, mixed mode, sharing)

Your docker version runs as well as your latest version in a conda env with java8 installed.
Do you have plans to update your code so it works under the current java?

Thanks

Hi there

just wanted to see whether you would consider maintaining a Docker container? I noticed the last update to the DISCVR-seq container is from a couple of years ago.

Thanks for considering!

Cheers

docker run ghcr.io/bimberlab/discvrseq --list
Exception in thread "main" WARNING: sun.reflect.Reflection.getCallerClass is not supported. This will impact performance.
java.lang.ExceptionInInitializerError
at org.broadinstitute.hellbender.Main.extractCommandLineProgram(Main.java:304)
at org.broadinstitute.hellbender.Main.setupConfigAndExtractProgram(Main.java:180)
at org.broadinstitute.hellbender.Main.mainEntry(Main.java:202)
at com.github.discvrseq.Main.main(Main.java:50)
Caused by: java.lang.UnsupportedOperationException: No class provided, and an appropriate one cannot be found.
at org.apache.logging.log4j.LogManager.callerClass(LogManager.java:573)
at org.apache.logging.log4j.LogManager.getLogger(LogManager.java:598)
at org.apache.logging.log4j.LogManager.getLogger(LogManager.java:585)
at org.broadinstitute.barclay.argparser.ClassFinder.(ClassFinder.java:29)
... 4 more

Hi,

I am trying to use the setKey option the same way I used in in GATK 3. But nothing added to the INFO field in the VCF.
The merging of the variant is done but not the info where it comes from.

java -jar /ngs/programs/DISCVRSeq/DISCVRSeq-1.3.13.jar MergeVcfsAndGenotypes -R {params.genome} -V:HC {input.HC} -V:FB {input.FB} -V:VD {input.VD} -V:MA {input.MA} -O {output.vcf} -genotypeMergeOption UNSORTED --setKey CALLER

Thanks for your help

Hello,

Would it be possible to generate csv files for "Variant Summary" displayed in Html report? Any API? I like to have csv files in my pipeline.

Thanks,

Justin

I tried this tool with multiple vcfs using PRIORITIZE option. With GATK it used to produce 'set' values indicating whether it passed in one caller/filtered in another caller and 'Intersection'. However, I see that DISCVRSeq MergeVcfsAndGenotypes generates only entries where 'set' shows only ROD names. The provided documentation does not indicate that any special option needs to be used to enable the desired behavior, though it mentions 'Intersection' tag. Is it possible that this feature is not fully implemented?

Hello,

This is a very interesting tool that I would like to try out. I'm wondering if there is a multithreaded option for VariantQC or if there is a recommended way of performing QC for whole genome sequencing data on ~2000 individuals.

• Split by individual?
• Split by chromosome? or smaller genomic regions?
• How to combine results from various runs?

Thanks,
-Jon

relates to a closed issue #164

for those like me who cannot handle multiple java on their machine and cannot use docker either, I managed to create a conda env with java jdk8 and within this I can run the java code

conda create -n java8
conda activate java8
mamba install -c bioconda java-jdk

java -version

 openjdk version "1.8.0_112"
 OpenJDK Runtime Environment (Zulu 8.19.0.1-linux64) (build 1.8.0_112-b16)
 OpenJDK 64-Bit Server VM (Zulu 8.19.0.1-linux64) (build 25.112-b16, mixed mode)

then run the java app with full path to it

java -jar /path/to/DISCVRSeq-1.3.10.jar -O vcfQC -R myref.fa -V variants.vcf.gz

making sure you have the .fai and .dict for the reference and the .tbi for the vcf

https://gatk.broadinstitute.org/hc/en-us/community/posts/12114421047195-java-lang-NullPointerException-error-in-VariantQC?page=1#community_comment_12301701379867

I have uploaded a question in the above link. but the GATK support team asked me to contact you here as the problem is related to DISCVRSeq tool.

I look forward to hearing the probable reason behind the error, or any guidance on how to solve this problem would be very helpful.

Thank you,
Ankita

Hello! The following problem occurred:

$ java -jar DISCVRSeq-1.22.jar --list
Error: Invalid or corrupt jarfile DISCVRSeq-1.22.jar

java -version
openjdk version "1.8.0_152-release"
OpenJDK Runtime Environment (build 1.8.0_152-release-1056-b12)
OpenJDK 64-Bit Server VM (build 25.152-b12, mixed mode)

Hello,

I would like to know if there is any possibilities to reorder the contig in the report ? For exemple if i used it for human data the order of chromosome is not really good :

thanks in advance,

Quentin

Hi,
I meet a problem about running VariantQC.

code:
java -jar ~/DISCVRSeq-1.19.jar VariantQC -O ./gbm39_vcf_report.html -R ~/ref-vcf-hg38/resources_broad_hg38_v0_Homo_sapiens_assembly38.fasta -V ./gbm39_hg38_sv.vcf

error log:

UNEXPECTED ERROR: Couldn't find state for chr9_KI270718v1_random at node org.broadinstitute.hellbender.tools.walkers.varianteval.stratifications.manager.StratNode@39fcbef6

Please, search for this error in our issue tracker or post a new one:
org.broadinstitute.hellbender.exceptions.GATKException: Couldn't find state for chr9_KI270718v1_random at node org.broadinstitute.hellbender.tools.walkers.varianteval.stratifications.manager.StratNode@39fcbef6

Thank so much!

Hello Everyone,

I encountered the following error when I ran VariantQC using the sample input file.
Does anyone know how to resolve this issue?

Thanks,

Justin

java -jar DISCVRSeq-1.07.jar VariantQC -R human_g1k_v37.fasta -V SimpleExample.vcf.gz -O output.html

12:05:59.713 INFO NativeLibraryLoader - Loading libgkl_compression.dylib from jar:file:/Users/justinzhang/app/DISCVRSeq-1.07/DISCVRSeq-1.07.jar!/com/intel/gkl/native/libgkl_compression.dylib
12:06:01.439 INFO VariantQC - ------------------------------------------------------------
12:06:01.440 INFO VariantQC - DISCVR-seq Toolkit v1.07
12:06:01.440 INFO VariantQC - For support and documentation go to https://software.broadinstitute.org/gatk/
12:06:01.441 INFO VariantQC - Executing as [email protected] on Mac OS X v10.13.6 x86_64
12:06:01.441 INFO VariantQC - Java runtime: Java HotSpot(TM) 64-Bit Server VM v13+33
12:06:01.442 INFO VariantQC - Start Date/Time: October 10, 2019 at 12:05:59 PM EDT
12:06:01.442 INFO VariantQC - ------------------------------------------------------------
12:06:01.442 INFO VariantQC - ------------------------------------------------------------
12:06:01.443 INFO VariantQC - HTSJDK Version: 2.18.0
12:06:01.443 INFO VariantQC - Picard Version: unknown
12:06:01.443 INFO VariantQC - HTSJDK Defaults.COMPRESSION_LEVEL : 2
12:06:01.444 INFO VariantQC - HTSJDK Defaults.USE_ASYNC_IO_READ_FOR_SAMTOOLS : false
12:06:01.444 INFO VariantQC - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_SAMTOOLS : true
12:06:01.444 INFO VariantQC - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_TRIBBLE : false
12:06:01.444 INFO VariantQC - Deflater: IntelDeflater
12:06:01.444 INFO VariantQC - Inflater: IntelInflater
12:06:01.444 INFO VariantQC - GCS max retries/reopens: 20
12:06:01.444 INFO VariantQC - Requester pays: disabled
12:06:01.445 INFO VariantQC - Initializing engine
12:06:01.637 INFO FeatureManager - Using codec VCFCodec to read file file:///Users/justinzhang/daiichi/SimpleExample.vcf.gz
12:06:01.731 INFO VariantQC - Done initializing engine
12:06:01.743 INFO VariantQC - Reference has too many contigs, subsetting to the first 40
log4j:WARN No appenders could be found for logger (org.reflections.Reflections).
log4j:WARN Please initialize the log4j system properly.
log4j:WARN See http://logging.apache.org/log4j/1.2/faq.html#noconfig for more info.
12:06:02.203 INFO VariantEvalChild - Creating 3 combinatorial stratification states
12:06:02.228 INFO VariantQC - Reference has too many contigs, subsetting to the first 40
12:06:02.232 INFO VariantEvalChild - Creating 123 combinatorial stratification states
12:06:02.267 INFO VariantEvalChild - Creating 33 combinatorial stratification states
12:06:02.290 INFO VariantEvalChild - Creating 264 combinatorial stratification states
12:06:02.319 INFO VariantQC - Reference has too many contigs, subsetting to the first 40
12:06:02.324 INFO VariantEvalChild - Creating 1353 combinatorial stratification states
12:06:02.350 INFO VariantQC - Reference has too many contigs, subsetting to the first 40
12:06:02.353 INFO VariantEvalChild - Creating 984 combinatorial stratification states
12:06:02.397 INFO VariantEvalChild - Creating 24 combinatorial stratification states
12:06:02.421 INFO VariantEvalChild - Creating 24 combinatorial stratification states
12:06:02.421 INFO ProgressMeter - Starting traversal
12:06:02.421 INFO ProgressMeter - Current Locus Elapsed Minutes Variants Processed Variants/Minute
12:06:02.424 INFO VariantQC - Shutting down engine
[October 10, 2019 at 12:06:02 PM EDT] com.github.discvrseq.walkers.variantqc.VariantQC done. Elapsed time: 0.05 minutes.
Runtime.totalMemory()=163577856
Exception in thread "main" java.lang.IncompatibleClassChangeError: Inconsistent constant pool data in classfile for class org/broadinstitute/hellbender/transformers/VariantTransformer. Method 'htsjdk.variant.variantcontext.VariantContext lambda$identity$76d6cab0$1(htsjdk.variant.variantcontext.VariantContext)' at index 65 is CONSTANT_MethodRef and should be CONSTANT_InterfaceMethodRef
at org.broadinstitute.hellbender.transformers.VariantTransformer.identity(VariantTransformer.java:32)
at org.broadinstitute.hellbender.engine.VariantWalkerBase.makePreVariantFilterTransformer(VariantWalkerBase.java:129)
at org.broadinstitute.hellbender.engine.VariantWalkerBase.getTransformedVariantStream(VariantWalkerBase.java:153)
at org.broadinstitute.hellbender.engine.VariantWalker.traverse(VariantWalker.java:103)
at org.broadinstitute.hellbender.engine.GATKTool.doWork(GATKTool.java:1039)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.runTool(CommandLineProgram.java:139)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMainPostParseArgs(CommandLineProgram.java:191)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:210)
at org.broadinstitute.hellbender.Main.runCommandLineProgram(Main.java:162)
at org.broadinstitute.hellbender.Main.mainEntry(Main.java:205)
at com.github.discvrseq.Main.main(Main.java:50)

I'm learning labkey. I'd like to meet you.

Hello,

I try to run VariantQC with singularity. But i obtained this error when i try to run more than one vcf. It's not possible to obtained one report for multiple vcf ?
I precise that if i run each vcf independently it's work.

UNEXPECTED ERROR: null

***********************************************************************
Please, search for this error in our issue tracker or post a new one:
java.lang.NullPointerException
        at com.github.discvrseq.walkers.variantqc.VariantQC.initializeReports(VariantQC.java:216)
        at com.github.discvrseq.walkers.variantqc.VariantQC.onTraversalStart(VariantQC.java:335)
        at org.broadinstitute.hellbender.engine.GATKTool.doWork(GATKTool.java:1061)
        at org.broadinstitute.hellbender.cmdline.CommandLineProgram.runTool(CommandLineProgram.java:140)
        at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMainPostParseArgs(CommandLineProgram.java:192)
        at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:211)
        at org.broadinstitute.hellbender.Main.runCommandLineProgram(Main.java:160)
        at org.broadinstitute.hellbender.Main.mainEntry(Main.java:203)
        at com.github.discvrseq.Main.main(Main.java:50)

Hi,
When I use MergeVcfsAndGenotypes to merge vcfs, I find the set is not in the INFO field, is it possible to add this information to the INFO field?

version :DISCVRSeq-1.3.17.jar

output.vcf:chr22	41526007	.	C	T	159	germline	AC=2;ADJAF=0.0109;AF=0.500;AN=4;AS_FilterStatus=SITE;AS_SB_TABLE=21,38|8,26;BIAS=2:2;DP=186;DUPRATE=0;ECNT=1;GERMQ=1;HIAF=0.3516;HICNT=32;HICOV=91;LSEQ=GTGATAAGAGAAATCAACAG;MBQ=20,32;MFRL=232,226;MMQ=60,60;MPOS=40;MQ=60;MSI=1;MSILEN=1;NM=1.1;ODDRATIO=1.71698;PMEAN=39.7;POPAF=3.91;PSTD=1;QSTD=1;QUAL=31.6;REFBIAS=21:38;ROQ=73;RSEQ=GTAAGTGATGAAATCTTTTG;SAMPLE=AG1449-1;SBF=0.35045;SHIFT3=0;SN=32;SPANPAIR=0;SPLITREAD=0;TLOD=86.62;TYPE=SNV;VARBIAS=8:25;VD=33	GT:AD:AF:ALD:DP:F1R2:F2R1:FAD:RD:SB:VD	0/1:59,34:0.389:.:93:17,14:24,9:43,27:.:21,38,8,26	0/1:59,33:0.3587:8,25:92:.:.:.:21,38:.:33
preput.vcf:chr22	41526007	.	C	T	159	germline	AC=2;ADJAF=0.0109;AF=0.500;AN=4;AS_FilterStatus=SITE;AS_SB_TABLE=21,38|8,26;BIAS=2:2;DP=186;DUPRATE=0;ECNT=1;GERMQ=1;HIAF=0.3516;HICNT=32;HICOV=91;LSEQ=GTGATAAGAGAAATCAACAG;MBQ=20,32;MFRL=232,226;MMQ=60,60;MPOS=40;MQ=60;MSI=1;MSILEN=1;NM=1.1;ODDRATIO=1.71698;PMEAN=39.7;POPAF=3.91;PSTD=1;QSTD=1;QUAL=31.6;REFBIAS=21:38;ROQ=73;RSEQ=GTAAGTGATGAAATCTTTTG;SAMPLE=AG1449-1;SBF=0.35045;SHIFT3=0;SN=32;SPANPAIR=0;SPLITREAD=0;TLOD=86.62;TYPE=SNV;VARBIAS=8:25;VD=33;set=filterInMutect2-vardict	GT:AD:AF:ALD:DP:F1R2:F2R1:FAD:RD:SB:VD	0/1:59,34:0.389:.,.:93:17,14:24,9:43,27:.,.:21,38,8,26	0/1:59,33:0.3587:8,25:92:.,.:.,.:.,.:21,38:.,.,.,.:33

Best,
xiucz

Hello,
I am trying to use DISCVRSeq in replacement of gatk 3.7 CombineVariants.
I use the :
java -jar ~/DISCVRSeq/DISCVRSeq-1.3.31.jar MergeVcfsAndGenotypes -R ~/hg19_UCSC_wo_hap/fasta/hg19.wo_hap.fasta -V:HC ./HC.test.vcf -V:DV ./DV.test.vcf -V:FB ./FB.test.vcf --genotypeMergeOption UNSORTED -setKey CALLER -O ~/UNSORTED.test.vcf.

But dont get info on all the callers that found the variant.
With gatk3.7, I used to have CALLER=HC-DV-FB, but with DISCVRSeq, I just got one CALLER: HC.

Is it the normal behaviour, or is there a bug that prevent the info of all the caller to be reported. How can I get the info otherwise.

Thanks

Hello,

I'm trying to build the image using your Dockerfile, but I'm getting some error in step 5/5

 => ERROR [5/5] RUN cd /discvr-build     && ./gradlew assemble     && ./gradlew shadowJar     && ./gradlew copyShadowJar     && mv build/jars/DISCVRSeq-*.jar /DISCVRSeq.jar     && cd /     && rm -Rf /discvr-build     && java -version     && which blastn     && whi  18.4s
------
 > [5/5] RUN cd /discvr-build     && ./gradlew assemble     && ./gradlew shadowJar     && ./gradlew copyShadowJar     && mv build/jars/DISCVRSeq-*.jar /DISCVRSeq.jar     && cd /     && rm -Rf /discvr-build     && java -version     && which blastn     && which primer3_core     && stat /DISCVRSeq.jar:
#9 0.280 Downloading https://services.gradle.org/distributions/gradle-7.3.2-bin.zip
#9 0.719 ..............................................................................................................
#9 3.574
#9 3.574 Welcome to Gradle 7.3.2!
#9 3.574
#9 3.575 Here are the highlights of this release:
#9 3.575  - Easily declare new test suites in Java projects
#9 3.575  - Support for Java 17
#9 3.575  - Support for Scala 3
#9 3.575
#9 3.575 For more details see https://docs.gradle.org/7.3.2/release-notes.html
#9 3.575
#9 3.575 Starting a Gradle Daemon (subsequent builds will be faster)
#9 17.87
#9 17.87 FAILURE: Build failed with an exception.
#9 17.87
#9 17.87 * Where:
#9 17.87 Build file '/discvr-build/build.gradle' line: 32
#9 17.87
#9 17.87 * What went wrong:
#9 17.87 A problem occurred evaluating root project 'DISCVRSeq'.
#9 17.87 > Cannot find '.git' directory
#9 17.88
#9 17.88 * Try:
#9 17.88 > Run with --stacktrace option to get the stack trace.
#9 17.88 > Run with --info or --debug option to get more log output.
#9 17.88 > Run with --scan to get full insights.
#9 17.88
#9 17.88 * Get more help at https://help.gradle.org
#9 17.88
#9 17.88 Deprecated Gradle features were used in this build, making it incompatible with Gradle 8.0.
#9 17.88
#9 17.88 You can use '--warning-mode all' to show the individual deprecation warnings and determine if they come from your own scripts or plugins.
#9 17.88
#9 17.88 See https://docs.gradle.org/7.3.2/userguide/command_line_interface.html#sec:command_line_warnings
#9 17.88
#9 17.88 BUILD FAILED in 17s
------
executor failed running [/bin/sh -c cd /discvr-build     && ./gradlew assemble     && ./gradlew shadowJar     && ./gradlew copyShadowJar     && mv build/jars/DISCVRSeq-*.jar /DISCVRSeq.jar     && cd /     && rm -Rf /discvr-build     && java -version     && which blastn     && which primer3_core     && stat /DISCVRSeq.jar]: exit code: 1

I'm proceeding with customizing the image, but without any customize this is failing.

version -> 1.3.19 Please advise

When a read needs to be soft-clipped from the 3'-end only by one base, the ClipOverlappingAlignment leaves the read as is (no clipping is performed). If the read is shifted to the right for one position, the ClipOverlappingAlignment performs the clipping as expected, as it soft-clips two bases (see example below, extensions changed as .bed and .sam not supported by github).
Tool version is 1.27.

intervals.csv
testSAM.txt
soft_clipped_SAM.txt

When a read fully overlaps a region (region is smaller than the read), the tool performs no clipping of the read, just leaves it as it is. It does require basically to create two new reads, one that ends at the region begin and the other that starts at the region end, but would this be possible in the future? The tool version is 1.27.

intervals.txt
testSAM.txt
soft_clipped_SAM.txt

Hello Everyone,

I encountered the following error when I ran VariantQC.
Does anyone know how to resolve this issue?

Thanks,

Andrew

java -jar DISCVRSeq-1.07.jar VariantQC
-R h.fasta \
-V Siple.vcf.gz
-O output.html

10:26:38.545 INFO VariantQC - ------------------------------------------------------------
10:26:38.546 INFO VariantQC - DISCVR-seq Toolkit v1.07
10:26:38.546 INFO VariantQC - For support and documentation go to https://software.broadinstitute.org/gatk/
10:26:38.546 INFO VariantQC - Executing as zyx@node03 on Linux v3.10.0-514.el7.x86_64 amd64
10:26:38.547 INFO VariantQC - Java runtime: OpenJDK 64-Bit Server VM v1.8.0_152-release-1056-b12
10:26:38.547 INFO VariantQC - Start Date/Time: October 11, 2019 10:26:38 AM CST
10:26:38.547 INFO VariantQC - ------------------------------------------------------------
10:26:38.547 INFO VariantQC - ------------------------------------------------------------
10:26:38.547 INFO VariantQC - HTSJDK Version: 2.18.0
10:26:38.548 INFO VariantQC - Picard Version: unknown
10:26:38.548 INFO VariantQC - HTSJDK Defaults.COMPRESSION_LEVEL : 2
10:26:38.548 INFO VariantQC - HTSJDK Defaults.USE_ASYNC_IO_READ_FOR_SAMTOOLS : false
10:26:38.548 INFO VariantQC - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_SAMTOOLS : true
10:26:38.548 INFO VariantQC - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_TRIBBLE : false
10:26:38.548 INFO VariantQC - Deflater: IntelDeflater
10:26:38.548 INFO VariantQC - Inflater: IntelInflater
10:26:38.548 INFO VariantQC - GCS max retries/reopens: 20
10:26:38.548 INFO VariantQC - Requester pays: disabled
10:26:38.548 INFO VariantQC - Initializing engine
10:26:40.168 INFO FeatureManager - Using codec VCFCodec to read file file:///home1/zyx/projects/aphid_evolution/data/3.result/MERGE.VCF/VariantQC/32samples.vcf
10:26:41.008 INFO VariantQC - Done initializing engine
10:26:41.108 INFO VariantQC - Reference has too many contigs, subsetting to the first 40
log4j:WARN No appenders could be found for logger (org.reflections.Reflections).
log4j:WARN Please initialize the log4j system properly.
log4j:WARN See http://logging.apache.org/log4j/1.2/faq.html#noconfig for more info.
10:26:42.945 INFO VariantEvalChild - Creating 3 combinatorial stratification states
10:26:43.385 INFO VariantQC - Reference has too many contigs, subsetting to the first 40
10:26:43.403 INFO VariantEvalChild - Creating 123 combinatorial stratification states
10:26:43.891 INFO VariantEvalChild - Creating 99 combinatorial stratification states
10:26:44.417 INFO VariantEvalChild - Creating 198 combinatorial stratification states
10:26:44.991 INFO VariantQC - Reference has too many contigs, subsetting to the first 40
10:26:44.997 INFO VariantEvalChild - Creating 4059 combinatorial stratification states
10:26:45.302 INFO VariantQC - Reference has too many contigs, subsetting to the first 40
10:26:45.305 INFO VariantEvalChild - Creating 246 combinatorial stratification states
10:26:45.645 INFO VariantEvalChild - Creating 6 combinatorial stratification states
10:26:46.035 INFO VariantEvalChild - Creating 6 combinatorial stratification states
10:26:46.036 INFO ProgressMeter - Starting traversal
10:26:46.036 INFO ProgressMeter - Current Locus Elapsed Minutes Variants Processed Variants/Minute
10:26:48.338 INFO VariantQC - Shutting down engine
[October 11, 2019 10:26:48 AM CST] com.github.discvrseq.walkers.variantqc.VariantQC done. Elapsed time: 0.17 minutes.
Runtime.totalMemory()=1346895872

UNEXPECTED ERROR: Couldn't find state for scaf_100267 at node org.broadinstitute.hellbender.tools.walkers.varianteval.stratifications.manager.StratNode@3a3e78f

Please, search for this error in our issue tracker or post a new one:
org.broadinstitute.hellbender.exceptions.GATKException: Couldn't find state for scaf_100267 at node org.broadinstitute.hellbender.tools.walkers.varianteval.stratifications.manager.StratNode@3a3e78f
at org.broadinstitute.hellbender.tools.walkers.varianteval.stratifications.manager.StratNode.find(StratNode.java:76)
at org.broadinstitute.hellbender.tools.walkers.varianteval.stratifications.manager.StratNode.find(StratNode.java:78)
at org.broadinstitute.hellbender.tools.walkers.varianteval.stratifications.manager.StratificationManager.getKeys(StratificationManager.java:173)
at org.broadinstitute.hellbender.tools.walkers.varianteval.stratifications.manager.StratificationManager.values(StratificationManager.java:224)
at org.broadinstitute.hellbender.tools.walkers.varianteval.VariantEval.getEvaluationContexts(VariantEval.java:635)
at org.broadinstitute.hellbender.tools.walkers.varianteval.VariantEval.processComp(VariantEval.java:566)
at org.broadinstitute.hellbender.tools.walkers.varianteval.VariantEval.doApply(VariantEval.java:538)
at org.broadinstitute.hellbender.tools.walkers.varianteval.VariantEval$PositionAggregator.callDoApply(VariantEval.java:473)
at org.broadinstitute.hellbender.tools.walkers.varianteval.VariantEval$PositionAggregator.addVariant(VariantEval.java:454)
at org.broadinstitute.hellbender.tools.walkers.varianteval.VariantEval$PositionAggregator.access$100(VariantEval.java:445)
at org.broadinstitute.hellbender.tools.walkers.varianteval.VariantEval.apply(VariantEval.java:487)
at com.github.discvrseq.walkers.variantqc.VariantQC.apply(VariantQC.java:370)
at org.broadinstitute.hellbender.engine.VariantWalker.lambda$traverse$0(VariantWalker.java:106)
at java.util.stream.ForEachOps$ForEachOp$OfRef.accept(ForEachOps.java:184)
at java.util.stream.ReferencePipeline$3$1.accept(ReferencePipeline.java:193)
at java.util.stream.ReferencePipeline$2$1.accept(ReferencePipeline.java:175)
at java.util.stream.ReferencePipeline$3$1.accept(ReferencePipeline.java:193)
at java.util.Iterator.forEachRemaining(Iterator.java:116)
at java.util.Spliterators$IteratorSpliterator.forEachRemaining(Spliterators.java:1801)
at java.util.stream.AbstractPipeline.copyInto(AbstractPipeline.java:481)
at java.util.stream.AbstractPipeline.wrapAndCopyInto(AbstractPipeline.java:471)
at java.util.stream.ForEachOps$ForEachOp.evaluateSequential(ForEachOps.java:151)
at java.util.stream.ForEachOps$ForEachOp$OfRef.evaluateSequential(ForEachOps.java:174)
at java.util.stream.AbstractPipeline.evaluate(AbstractPipeline.java:234)
at java.util.stream.ReferencePipeline.forEach(ReferencePipeline.java:418)
at org.broadinstitute.hellbender.engine.VariantWalker.traverse(VariantWalker.java:104)
at org.broadinstitute.hellbender.engine.GATKTool.doWork(GATKTool.java:1039)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.runTool(CommandLineProgram.java:139)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMainPostParseArgs(CommandLineProgram.java:191)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:210)
at org.broadinstitute.hellbender.Main.runCommandLineProgram(Main.java:162)
at org.broadinstitute.hellbender.Main.mainEntry(Main.java:205)
at com.github.discvrseq.Main.main(Main.java:50)

Hello All, I needed to check quality of Variant calls after calling variants through Mutect2 and filtration. I used VariantQC as described in the manual, but it stopped while giving this error. Anyone can help me with it?
Thank you

Hi BimberLab,

I am trying to use VariantQC on a VCF based on a wheat genome. Wheat genomes are huge and a tbi index can't handle these instead a csi index is needed. Could you add support for csi indices?
I tried using gatk IndexFeatureFile for indexing but it also does not seem to support large genomes.

Thanks!
Janina

Hi,

I am running VariantQC using docker (tag latest) with multiple Input VCFs (-V sampleName sampleName.vcf.gz ) option. I have more than 1500 samples that I would like to have in the same report, but when I run it I get an error out of memory.
I have tried to specify the memory size in docker command but did not help. Moreover, I have increased the java heap memory size (-Xms ) but does not works as a input option.

Do you know a way to increase the memory ?
Have you tried to run it with the multiple Input VCFs on so many samples ?

Here is the log of the running. The problem seems to be related to generated json objects.

14:07:21.241 INFO ProgressMeter - Traversal complete. Processed 8934114 total variants in 55.9 minutes.
14:07:23.738 INFO VariantQC - Shutting down engine
[October 7, 2021 2:07:23 PM UTC] com.github.discvrseq.walkers.variantqc.VariantQC done. Elapsed time: 55.98 minutes.
Runtime.totalMemory()=1276641280

UNEXPECTED ERROR: Comparison method violates its general contract!

Please, search for this error in our issue tracker or post a new one:
java.lang.IllegalArgumentException: Comparison method violates its general contract!
at java.util.TimSort.mergeLo(TimSort.java:777)
at java.util.TimSort.mergeAt(TimSort.java:514)
at java.util.TimSort.mergeCollapse(TimSort.java:441)
at java.util.TimSort.sort(TimSort.java:245)
at java.util.Arrays.sort(Arrays.java:1512)
at java.util.ArrayList.sort(ArrayList.java:1464)
at java.util.Collections.sort(Collections.java:177)
at com.github.discvrseq.walkers.variantqc.ReportDescriptor.getSortedRows(ReportDescriptor.java:148)
at com.github.discvrseq.walkers.variantqc.TableReportDescriptor.getReportJson(TableReportDescriptor.java:66)
at com.github.discvrseq.walkers.variantqc.SectionJsonDescriptor.getConfig(SectionJsonDescriptor.java:44)
at com.github.discvrseq.walkers.variantqc.HtmlGenerator.generateHtml(HtmlGenerator.java:108)
at com.github.discvrseq.walkers.variantqc.VariantQC.onTraversalSuccess(VariantQC.java:492)
at org.broadinstitute.hellbender.engine.GATKTool.doWork(GATKTool.java:1067)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.runTool(CommandLineProgram.java:140)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMainPostParseArgs(CommandLineProgram.java:192)
at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:211)
at org.broadinstitute.hellbender.Main.runCommandLineProgram(Main.java:160)
at org.broadinstitute.hellbender.Main.mainEntry(Main.java:203)
at com.github.discvrseq.Main.main(Main.java:50)