dreichlab / adna Goto Github PK
View Code? Open in Web Editor NEWProcessing WGS aDNA data using the ReichLab protocol
Processing WGS aDNA data using the ReichLab protocol
I think the following merge should be unambiguous. Read 1 is a 69 base-pair sequence with the first barcode from the first set prepended. Read 2 is a reverse complement of the 69 base-pair sequence with the first barcode from the second set prepended.
@NS500217:348:HTW2FBGXY:1:11101:22352:1064 1:N:0:0
TGACGCACTAGCATTACTTATATGATATGTCTCCATACCAATTACAATCTCCAAGTGAACGAGATCGGAAGAGCAC
+
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
@NS500217:348:HTW2FBGXY:1:11101:22352:1064 2:N:0:0
GTCTCAAGTGCTCTTCCGATCTCGTTCACTTGGAGATTGTAATTGGTATGGAGACATATCATATAAGTAATGCTAG
+
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
Barcodes are:
TGACGCA:ATCGTGC:CAGTATG:GCTACAT
GTCTCAA:TAGAGCC:ACTCTGG:CGAGATT
I think the problem is the same merge is counted in both the forward and reverse analysis steps.
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.