Giter VIP home page Giter VIP logo

bio-tools-codonopttable's Introduction

Bio-Tools-CodonOptTable

A codon quality check tool, it produces a Codon Optimization table to see the quality of each codon.

The simplest way of depiction is to plot the codon usage frequency that can be found in common codon usage tables. A more elaborate way to depict the codon quality is to convert the codon usage frequency into relative adaptiveness values. In contrast to the codon usage frequency the relative adaptiveness takes into account the number of codons which code for the respective amino acid.

We produces each codon frequency, Relative Synonymous Codons Uses and Relative Adaptiveness of a Codon that can help to calculate the Codon Adaptation Index (CAI) of a gene.

We generate a Graph between RSCU & RAC for better analysis.

Reference:
http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=3547335

USES or Examples

You can use this module in the following ways

    use Bio::Tools::CodonOptTable;

    my $seqobj = Bio::Tools::CodonOptTable->new(
        -seq              => 'ATGGGGTGGGCACCATGCTGCTGTCGTGAATTTGGGCACGATGGTGTACGTGCTCGTAGCTAGGGTGGGTGGTTTG',
        -id               => 'GeneFragment-12',
        -accession_number => 'Myseq1',
        -alphabet         => 'dna',
        -is_circular      => 1,
        -genetic_code     => 1,
    );
    
    #If you wanna read from file
    my $seqobj = Bio::Tools::CodonOptTable->new(
        -file         => "contig.fasta",
        -format       => 'Fasta',
        -genetic_code => 1,
    );
    
    #If you have Accession number and want to get file from NCBI
    my $seqobj = Bio::Tools::CodonOptTable->new(
        -ncbi_id      => "J00522",
        -genetic_code => 1,
    );
    
    my $myCodons = $seqobj->rscu_rac_table();
    
    if ($myCodons) {
        foreach my $each_aa (@$myCodons) {
            print "Codon      : ", $each_aa->{'codon'},     "\t";
            print "Frequency  : ", $each_aa->{'frequency'}, "\t";
            print "AminoAcid  : ", $each_aa->{'aa_name'},   "\t";
            print "RSCU Value : ", $each_aa->{'rscu'},      "\t";    #Relative Synonymous Codons Uses
            print "RAC Value  : ", $each_aa->{'rac'},       "\t";    #Relative Adaptiveness of a Codon
            print "\n";
        }
    }
    
    # To get the prefered codon list based on RSCU & RAC Values
    my $prefered_codons = $seqobj->prefered_codon($myCodons);
    while ( my ( $amino_acid, $codon ) = each(%$prefered_codons) ) {
        print "AminoAcid : $amino_acid \t Codon : $codon\n";
    }
    
    # To produce a graph between RSCU & RAC
    # Graph output file extension should be GIF, we support GIF only
    $seqobj->generate_graph( $myCodons, $outfile_name );
    
    # To Calculate Codon Adaptation Index (CAI)    
    my $gene_cai = $seqobj->calculate_cai($myCodons);

    # To Produce HTML report
    # This function will generate HTML report, outfile extension should be .html
    $seqobj->generate_report($outfile_name);

INSTALLATION

To install this module, run the following commands:

	perl Makefile.PL
	make
	make test
	make install

SUPPORT AND DOCUMENTATION

After installing, you can find documentation for this module with the
perldoc command.

    perldoc Bio::Tools::CodonOptTable

You can also look for information at:

    RT, CPAN's request tracker
        http://rt.cpan.org/NoAuth/Bugs.html?Dist=Bio-Tools-CodonOptTable

    AnnoCPAN, Annotated CPAN documentation
        http://annocpan.org/dist/Bio-Tools-CodonOptTable

    CPAN Ratings
        http://cpanratings.perl.org/d/Bio-Tools-CodonOptTable

    Search CPAN
        http://search.cpan.org/dist/Bio-Tools-CodonOptTable


COPYRIGHT AND LICENCE

Copyright (C) 2010 Rakesh Kumar Shardiwal

This program is free software; you can redistribute it and/or modify it
under the same terms as Perl itself.

bio-tools-codonopttable's People

Contributors

shardiwal avatar

Watchers

 avatar  avatar  avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.