Giter VIP home page Giter VIP logo

adapter4srna's Introduction

adapter4srna

Adapter in small RNA sequencing

This is an open access reporitory to collect all used adapter sequences in currently commercial available and discontinued kits.

Any comments and contributions are welcomed.

3' adapter for small RNA sequencing on Illumina platform

Vendor Kit Version 3' Adapter sequence
New England Biolabs NEBNext Multiplex Small RNA Library Prep Kit for Illumina V3 5'-AGATCGGAAGAGCACACGTCT-3'
Illumina TruSeq Small RNA Version 5’-TGGAATTCTCGGGTGCCAAGG-3'
PerkinElmer NEXTflex Small RNA Sequencing Kit ** V3 5’-TGGAATTCTCGGGTGCCAAGG-3'
Qiagen QIAseq miRNA Library Kit Version 5’-AACTGTAGGCACCATCAAT-3'
Lexogen Small RNA-Seq Library Prep Kit Version 5’-TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC-3'
SeqMatic TailorMix miRNA Sample Preparation Kit V2 5’-TGGAATTCTCGGGTGCCAAGG-3'
Takara SMARTer smRNA-Seq Kit for Illumina Version 5’-AAAAAAAAAA-3'
TriLink CleanTag Small RNA Library Prep Kit Version 5'-TGGAATTCTCGGGTGCCAAGG-3'
Diagenode CATS small RNA-seq Kit Version 5'-GATCGGAAGAGCACACGTCTG-3'
GenXPro TrueQuant SmallRNA Seq Kit for Ultra Low Input Version TODO
Epicentre ScriptMiner Small RNA-Seq Library Preparation Kit Version ~~ ~~
Life Technology SREK, Small RNA Expression Kit version C ~~ ~~

**4 random bases

Kit Discontinued kit

CATS Small RNA sequencing kit for Illumina

Version 2 | 01.17

cutadapt -u 3 input_file.fastq | cutadapt -a AAAAAAAA - | cutadapt -a AAAAAAAN$ -a AAAAAAN$ -a AAAAAN$ - | cutadapt -a AGAGCACACGTCTG - | cutadapt -O 8 -g GTTCAGAGTTCTACAGTCCGACGATCNNN - | cutadapt -m 18 -o output_file.fastq -

Version 2 | 03.17

cutadapt -u 3 input_file.fastq | cutadapt -a AAAAAAAA - | cutadapt -a AAAAAAAN$ -a AAAAAAN$ -a AAAAAN$ - | cutadapt -a AGAGCACACGTCTG - | cutadapt -O 8 -g GTTCAGAGTTCTACAGTCCGACGATCNNN - | cutadapt -m 18 -o output_file.fastq -

Version 2 | 09.17

cutadapt --trim-n -a GATCGGAAGAGCACACGTCTG -a AGAGCACACGTCTG <input.file> | cutadapt -u 3 -a A{100} --no-indels -e 0.16666666666666666 - | cutadapt -O 8 --match-read-wildcards -g GTTCAGAGTTCTACAGTCCGACGATCSSS -m 18 -o <output.file> -

Contributing

Any comments and contributions are welcome. Pull requests are welcome.

adapter4srna's People

Stargazers

 avatar  avatar  avatar  avatar

Watchers

 avatar  avatar

Forkers

xmabio

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.