This Python code translates a DNA sequence into its corresponding protein sequence.

• DNA Codon Table: Utilizes a dictionary (codon_table) to map DNA codons (triplets of nucleotides) to their corresponding amino acids.
• Iterative Translation: Iterates through the DNA sequence in steps of 3 (codon length) to extract codons.
• Amino Acid Lookup: Looks up each codon in the codon_table to retrieve the associated amino acid.
• Stop Codon Handling: Terminates translation upon encountering a stop codon ("*").
• Unknown Codon Handling: Represents unknown codons (not found in the table) with "X" in the protein sequence.
• Protein Sequence Construction: Builds the protein sequence by concatenating the translated amino acids.

dna_sequence = "ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGATGCGGCGCAGGAAGGGGTCGGAGTGA"
protein_sequence = translate_dna_to_protein(dna_sequence)
print("DNA Sequence:", dna_sequence)
print("Protein Sequence:", protein_sequence)