miRNA to feature table

orgid miRNAid -> name , uniquename [P_M00018] -- 610248 miRNAseq -> residues, sequlen, md5 [UCCAAAGGGAUCGCAUUGAUC] type_id -> miRNA (name in cvterm, SO) [560]

load pre_miRNA to feature table

pre_miRNA feature pre_miRNAid -> name, uniquename [H000006] -- 610249 pre_miRNAseq -> residues, seqlen, md5 UCCAAAGGGAUCGCAUUGAUCCAAUGUUUGUCUUGUCUU AUCAAUGAUAUGUUGGAGUUGAUUCUCGAUCAAUUAUUGGAUCGUGCGAUCCCUUAGGA type_id -> pre_miRNA (name in cvterm, SO) [562]

load miRNA and pre_miRNA to feature relationship table

subject_id : miRNA [610248] subject object_id : pre_miRNA [610249] object type_id : part_of (name in cvterm, SO) [158] part of

=== I put the -42.60 of olding_energy to value of feature relationship table

insert tye folding_energy to cvterm on install file

load folding_energy to feature_replationshipprop table feature_relationship_id type_id : folding_energy (name in cvterm, tripal) value : -40.60 rank : 0

load miRNA and pre_miRNA to feature location feature_id : miRNA [610248] srcfeature_id: pre_miRNA [610249] fmin: start [1] fmax: end [21] strand: -1, or 1, [1]

======== this contig is just a example ======== [610250] feature id [Scaffold000029] name and uniquename [414] supercontig of cvterm

feature relationship 610249 610250 158

================================================= Target

feature relationship dbxref db_id [2] tripal accession [target_to] description [miRNA/siRNA target to other long RNA] get dbxref_id [95918]

cvterm cv_id [5] tripal name [target_to] definition miRNA/siRNA target to other long RNA dbxref_id [95918] [place dbxref_id to here]

the return cvterm id is : 48990

++++ write the dbxref and cvterm into install file ++++

== feature relationship table [610248] P_M00018 [3] orange1.1g015632m [48990] type [2] value for target score

== insert mirna target to other table structure mirna_id [feature_id] target_id [feature_id] target_start target_end score align_query align_hit align_string strand

===============================================

== insert mirna conserved table structure mirna_id [feature_id] unique hit_id [just name] unique align_query align_string align_hit

== insert mirna star table structure hairpin_id unique srna_id unique index start end

#Installation

bug1 why adjust p value is small than raw p value ?

1. create soft link of miRNA_target_pred.pl to path. Example:

ln -s /var/www/html/sites/all/modules/tripal_miRNA/miRNA_target_pred.pl /usr/local/bin

2. install mirtarget module

drush pm-enable mirtarget

3. add node of miRNA or mRNA sequence