| Due: 5pm on Apr 19

See here for the general workflow.

Your answers should be in YAML format in a file called answers.yml at the top level of the repository.

# answers.yml should look like this:
answer-1: 123
answer-2: 456

Write a Python program to read the lamina.bed file and report the following:

1. On what chromosome is the region with the largest start position (2nd column) in lamina.bed? (10 points)

2. What is the region with the largest end position on chrY in lamina.bed? (10 points) Report as::

   chrom start end value region_length

Use Python to read the SP1.fq file in the data-sets repository. Recall that FASTQ records are comprised of 4 sections; in this case each section will be on a unique line::

@cluster_2:UMI_ATTCCG             # record name
TTTCCGGGGCACATAATCTTCAGCCGGGCGC   # DNA sequence
+                                 # empty line; starts with '+'
9C;=;=<9@4868>9:67AA<9>65<=>591   # phred-scaled quality scores

Write a Python program to parse the FASTQ records and report the following:

3. Which of the first 10 sequence records has the largest number of 'C' residues in the sequence? Report its record name (10 points).

4. For each record, Covert each character in the quality score to a number, and sum the numbers. Use the python function ord to convert characters to numbers. Report the largest total quality score (10 points).

5. Report the revese complement of each of the first 10 sequences (10 points). You will have to define a reverse_complement() method, or find one from another package.

Note that the reverse complement of 5'-AGCTCGTA-3' is 5'-TACGAGCT-3'.