Add flexibility cprimers / vprimers in R1 or R2 about airrflow HOT 6 CLOSED

Hi @fabio-t,
I'm working on that at the moment, to make sure that I understand your sequencing protocol and I can include it:

• Do you use PCR amplification? Or another protocol such as RACE-5'?
• Does your primer constructs look like that but the V primers in the R2 reads instead?
• Do you use UMIs in your protocol? And if so, do you read them with the indices or are they included in one of the primers?
  If you have a short drawing of your construct that would be of course fabulous!

from airrflow.

Hi @fabio-t,

thanks a lot for all the info. I've added a fix for this, I will double check that it should work for you and fix another issue, and then you should be able to test the pipeline running the dsl2 branch with -r dsl2. Will keep you updated :)

from airrflow.

This is the protocol used: https://www.nature.com/articles/nprot.2016.093

Yes, generally it looks like that (it's a bit more complicated.. see below) and yes, we use UMIs (12-bp). This is the barcode pattern I use in MIGEC for UMI demultiplexing: CAGTggtatcaacgcaGAGTNNNNtNNNNtNNNNtct

I'm attaching a few hundred reads from one of our samples (mouse, IGH). Maybe this can be helpful? https://file.io/5DjlWUpZ7kjh

from airrflow.

Example result from IMGT V-quest:

R1:

R2:

from airrflow.

For convenience, this is the cprimer at the beginning of R2: ATTGGGCAGCCCTGATTTCAGTGGGTAGATGGTG

from airrflow.

This has been added to the 2.0.0 release

from airrflow.