Comments (2)
It looks like your command is on multiple lines. You can put everything on one line or try adding '\' at the end of every line except for the last line. E.g.,
nextflow run nf-core/ampliseq \
-profile singularity \
--input "/Biovigilance_2021/ITS/" \
--FW_primer AHCGATGAAGAACRYAG \
--RV_primer CTTATTGATATGCTTAAGTTCAG \
--outdir “/ITS_2021/”
from ampliseq.
Or you just write all in one line, e.g.
nextflow run nf-core/ampliseq -profile singularity --input "/Biovigilance_2021/ITS/" --FW_primer AHCGATGAAGAACRYAG --RV_primer CTTATTGATATGCTTAAGTTCAG --outdir “/ITS_2021/”
I close that here, but please feel free to open another issue. For beginner questions it might be also helpful to have a look at the nf-core slack channel #ampliseq
.
from ampliseq.
Related Issues (20)
- Phyloseq object creation will fail if any samples have all reads removed by the tax filtering step HOT 5
- Add blast-consensus support to Ampliseq HOT 1
- Add greengenes2 2022.10 support to Ampliseq HOT 1
- Add custom qiime reference database support to Ampliseq. HOT 2
- Edge case: Clustering with VSEARCH fails at QIIME2_INSEQ HOT 1
- Allow to analyse 454 sequencing data HOT 2
- Add option to assign ASV to multiple species with DADA2 HOT 3
- Debug information for docker-based run. HOT 4
- Allow stratified output from picrust2 HOT 4
- nf-core/ampliseq with conda - change bioconductor-biostrings HOT 2
- Launch webpage not working HOT 4
- Adding qza file for downstream analysis in R HOT 3
- When using `--vsearch_cluster`, if you have many thousands of clusters, `AMPLISEQ:FILTER_CLUSTERS` will fail with an `Argument list too long` error. HOT 8
- test_full Cannot access file fastq HOT 1
- Multipe region amplicon sequencing analysis support (5R / SMURF / q2-sidle) HOT 1
- Getting ca 50% more ASVs than when using DADA2 on QIIME2 HOT 2
- ampliseq fails during taxonomy assignation when processing ITS sequences HOT 14
- Error No subject alternative DNS name matching zenodo.org found HOT 2
- minor improvement of sort() before denoising with method = "radix HOT 2
- 12S taxonomic classification databases HOT 3
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from ampliseq.