• expand the description sentence:

  A compilation of 18S rRNA primers from the literature, mapped onto the reference SSU sequence for Saccharomyces cerevisiae (1800 nucleotides, first nucleotide marked as zero) .

• drop _yeast in column names (description already states that we map on yeast),
• replace the doi column with a reference column to make it easier to read and to spot mistakes: Medlin et al. (1988) rather than https://doi.org/10.1016/0378-1119(88)90066-2 (that's something that can be done progressively),
• add a final column with the reverse-complement of the primer sequence to capture all web searches, including queries for primers published in the wrong direction,
• (optional) add a column for known synonyms (for example: FAD4 is a synonym of EukB). That could be capture more web searches.

In the primer table wiki page:

• the doi of Keeling, 2002 is pointing to Jasso-Selles et al. 2017,
• 3NDF is spelled 3NDf in the original publication, and the original publication should be Cavalier-Smith et al. (2009),
• Cavalier-Smith et al. (2009) also gives two primer sequences that are not in the primer table:

DNA was amplified by polymerase chain reaction (PCR) using the general-eukaryotic primers 25F (5′-CAT ATG CTT GTC TCA AAG ATT AAG CCA-3′) and 1801R (5′-TGA TCC TTC TGC AGG TTC ACC T-3′).

• there is a reference older than 2016 for Nex_18S_0587_F, with the name 528F: Alves-de-Souza et al. 2011,
• Alves-de-Souza et al. 2011 also has a list of 18S primers (page 2128),
• the reference for UNonMetR should be Bower et al., (2004),
• UNonMetF is a synonym for "18S-EUK581-F", see Bower et al., (2004)'s abstract,
• UNonMetR is a synonym for "18S-EUK1134-R", see Bower et al., (2004)'s abstract

Interestingly, when searching for a primer sequence, now google sometimes returns the wiki page among the first-page results :-)

Quick note. The publication Guillou et al. 2004 gives older references than the one we currently have for primers 329F/329R and 528F:

The entire SSU rDNA gene was amplified using the eukaryotic primers Euk 328f (5′-ACC TGG TTG ATC CTG CCA G-3′) and Euk 329r (5′-TGA TCC TTC YGC AGG TTC AC-3′) as described in
Moon-van der Staay et al. (2001).

Partial sequences of PCR products or of clones representative of each RFLP pattern obtained were determined by Qiagen Genomics Sequencing Services, using the internal primer Euk 528f (5′-GCG GTA ATT CCA GCT CCA A-3′; Elwood et al. 1985); (3).

I need to check that.

Some of the 18S and ITS primers listed in that book chapter from 1990 are still in use today. We should add the 18S primers to our database.

NS1 (forward): GTAGTCATATGCTTGTCTC
NS2 (reverse): GGCTGCTGGCACCAGACTTGC
NS3 (forward): GCAAGTCTGGTGCCAGCAGCC
NS4 (reverse): CTTCCGTCAATTCCTTTAAG
NS5 (forward): AACTTAAAGGAATTGACGGAAG
NS6 (reverse): GCATCACAGACCTGTTATTGCCTC
NS7 (forward): GAGGCAATAACAGGTCTGTGATGC
NS8 (reverse): TCCGCAGGTTCACCTACGGA

There is no doi, but a scan of the chapter is available.

Also, it might be interesting to include ITS1 (TCCGTAGGTGAACCTGCGG) as it is anchored in the 18S. It is so widely used for fungi studies that, at the very least, it would increase the visibility of this repository.

I've seen these primers used in several studies, so you might want to consider including them in the 18S primer database. The original publication seems to be:

Vainio EJ, Hantula J (2000) Direct analysis of wood-inhabiting fungi using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Mycol Res 104: 927–936. https://doi.org/10.1017/S0953756200002471

From table 2 in Vainio & Hantula (2000):

FF390: CGATAACGAACGAGACCT
FF700: GATACCGTNGTAGTCT
FF1100: CCAGCTCCAATAGCGTATATTA

FR1: ANCCATTCAATCGGTANT (reverse)

Note that, in the original publication, primer sequences contain inosine (I) symbols. I've replaced them with Ns.

Niwa et al. (2011) published a list of primer sequences (in supplementary Table S1). I think most of these primers are not yet present in our primer table.

| Primer   | Sequence (5’-3’)         | Targets (source)                  |
|----------+--------------------------+-----------------------------------|
| Pbr1     | GGTTGATCCTGCCAGTAGTC     | SSU rDNA (This study)             |
| Pbr1r    | GACTACTGGCAGGATCAACC     | SSU rDNA (This study)             |
| Pb121    | GGATACAAAAACCAAACCTGGC   | SSU rDNA (This study)             |
| Pb121r   | GCCAGGTTTGGTTTTTGTATCC   | SSU rDNA (This study)             |
| Pbr2r    | CTCTATGCCCGAATCGCTTC     | SSU rDNA (This study)             |
| Pbr4     | GTGTCGCTTAAGATATAGTC     | SSU rDNA (This study)             |
| Pbr4r    | GACTATATCTTAAGCGACAC     | SSU rDNA (This study)             |
| LRP4     | CGTTGGAAGGCGGCATCA       | LSU rDNA (This study)             |
| NDL22f   | CGTCTTGAAACACGGACCA      | LSU rDNA (This study)             |
| NDL22    | TGGTCCGTGTTTCAAGACG      | LSU rDNA (van Tuinen et al. 1998) |
| 28s1     | CCGGAGCTGAAACAGCTT       | LSU rDNA (This study)             |
| 28s1r    | AAGCTGTTTCAGCTCCGG       | LSU rDNA (This study)             |
| 28S3     | GGGGAATCCGACTGTTTAATT    | LSU rDNA (This study)             |
| 28s3r    | AATTAAACAGTCGGATTCCCC    | LSU rDNA (This study)             |
| V282     | GTGGGATAACGGCTGAACG      | LSU rDNA (This study)             |
| P282r    | CGTTCAGCCGTAATCCTAC      | LSU rDNA (This study)             |
| IGS1r    | GTTGATGTGTTGTAAGGGGTATG  | IGS (This study)                  |
| IGSa-10f | GCATCACCTTAGCATTCGTTC    | IGS (This study)                  |
|----------+--------------------------+-----------------------------------|

DOI URLs appear as html links in the exported tsv table:

<a href="https://doi.org/10.3354/ame043079">10.3354/ame043079</a>

not sure what could be done here, but we will have to see if it is a problem for users.

I test the Primer 1380F CCCTGCCHTTTGTACACAC -1510R CCTTCYGCAGGTTCACCTAC , in the test primer set module, only 26.88% sequences matching revervse primer. However, for the same primers in the Amplification-details, 79.17% could match reverse primer. Why ?

A possible enhancement: if plots could be served as SVG or any another vectorial format rather than PNG, primer names and other texts would be searchable, and plots would be scalable to any screen size.