archived code for siRNA database search and alignment
About
Webpage to query known siRNA and identify siRNA targets on a mRNA sequence of interest
Source code:
/var/www/poberoi1/final.tar
Detailed Usage
This webpage allows users to search an siRNA database using one of the following criterion, or a combination:
-
siRNA sequence - this is the siRNA sequence for the guide strand. A user could use this search function to see if their siRNA sequence is already known or if it is known to target the mRNA they expect (Example: AAUGGUGGAGUAGAAGACAUG)
-
Gene ID - the unique gene identifiers used by NCBI databases. (Example: 40254822)
-
Gene Name - the name used for the targeted gene (Example: death-associated protein kinase 3, or, ATP-binding)
-
Accession ID - unique identifier for gene product such as mRNA or non-protein coding RNAs (Example: NM_181870)
An alternative way to search the siRNA database is by pasting in an mRNA sequence of interest, which will align known siRNA target sites to the query mRNA sequence. (Example: GCAUGCUCGUAGUCGUUUUGAGGCUCCACCUGCCGCAACGCGCGCAUCAUCGUACGG)
Begin typing in any of the search textboxes to pull up an autocomplete list with a few examples of search terms.
To see a list of the 1266 records in the database, hit search on the homepage without any search criteria.
Since RNA sequences are often saved in databases with thymine (T) instead of uracil (U), a user may enter an mRNA or siRNA sequence with either T or U to query the database.