The repo contains:
- The official implementation of DNABERT-2: Efficient Foundation Model and Benchmark for Multi-Species Genome
- Genome Understanding Evaluation (GUE): a comprehensize benchmark containing 28 datasets for multi-species genome understanding benchmark.
- 1. Introduction
- 2. Model and Data
- 3. Setup Environment
- 4. Quick Start
- 5. Pre-Training
- 6. Evaluation
- 7. Citation
DNABERT-2 is a foundation model trained on large-scale multi-species genome that achieves the state-of-the-art performanan on
The pre-trained models is available at Huggingface as zhihan1996/DNABERT-2-117M
. Link to HuggingFace ModelHub. Link For Direct Downloads.
GUE is a comprehensive benchmark for genome understanding consising of
# create and activate virtual python environment
conda create -n dna python=3.8
conda activate dna
# install required packages
python3 -m pip install -r requirements.txt
Our model is easy to use with the transformers package.
To load the model from huggingface:
import torch
from transformers import AutoTokenizer, AutoModel
tokenizer = AutoTokenizer.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True)
model = AutoModel.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True)
To calculate the embedding of a dna sequence
dna = "ACGTAGCATCGGATCTATCTATCGACACTTGGTTATCGATCTACGAGCATCTCGTTAGC"
inputs = tokenizer(dna, return_tensors = 'pt')["input_ids"]
hidden_states = model(inputs)[0] # [1, sequence_length, 768]
# embedding with mean pooling
embedding_mean = torch.mean(hidden_states[0], dim=0)
print(embedding_mean.shape) # expect to be 768
# embedding with max pooling
embedding_max = torch.max(hidden_states[0], dim=0)[0]
print(embedding_max.shape) # expect to be 768
Codes for pre-training is coming soon.
Please first download the GUE dataset from here. Then run the scripts to evaluate on all the tasks.
Current script is set to use DataParallel
for training on 4 GPUs. If you have different number of GPUs, please change the per_device_train_batch_size
and gradient_accumulation_steps
accordingly to adjust the global batch size to 32 to replicate the results in the paper. If you would like to perform distributed multi-gpu training (e.g., with DistributedDataParallel
), simply change python
to torchrun --nproc_per_node ${n_gpu}
.
export DATA_PATH=/path/to/GUE #(e.g., /home/user)
cd finetune
# Evaluate DNABERT-2 on GUE
sh scripts/run_dnabert2.sh DATA_PATH
# Evaluate DNABERT (e.g., DNABERT with 3-mer) on GUE
# 3 for 3-mer, 4 for 4-mer, 5 for 5-mer, 6 for 6-mer
sh scripts/run_dnabert1.sh DATA_PATH 3
# Evaluate Nucleotide Transformers on GUE
# 0 for 500m-1000g, 1 for 500m-human-ref, 2 for 2.5b-1000g, 3 for 2.5b-multi-species
sh scripts/run_nt.sh DATA_PATH 0
Comming soon.
If you have any question regarding our paper or codes, please feel free to start an issue or email Zhihan Zhou ([email protected]).
If you use DNABERT-2 in your work, please kindly cite our paper:
DNABERT-2
@misc{zhou2023dnabert2,
title={DNABERT-2: Efficient Foundation Model and Benchmark For Multi-Species Genome},
author={Zhihan Zhou and Yanrong Ji and Weijian Li and Pratik Dutta and Ramana Davuluri and Han Liu},
year={2023},
eprint={2306.15006},
archivePrefix={arXiv},
primaryClass={q-bio.GN}
}
DNABERT
@article{ji2021dnabert,
author = {Ji, Yanrong and Zhou, Zhihan and Liu, Han and Davuluri, Ramana V},
title = "{DNABERT: pre-trained Bidirectional Encoder Representations from Transformers model for DNA-language in genome}",
journal = {Bioinformatics},
volume = {37},
number = {15},
pages = {2112-2120},
year = {2021},
month = {02},
issn = {1367-4803},
doi = {10.1093/bioinformatics/btab083},
url = {https://doi.org/10.1093/bioinformatics/btab083},
eprint = {https://academic.oup.com/bioinformatics/article-pdf/37/15/2112/50578892/btab083.pdf},
}