Giter VIP home page Giter VIP logo

minsepiesad-sys's Introduction

MinsePIE   🥧

Find the code for the manuscript resubmission in scripts.

Modelling insertion efficiency for Prime Insertion Experiments

Alt Text

Writing short sequences into the genome with prime eiditng faciliates protein tagging, correction of pathogenic deletions and many more exciting applications. We studied the features that influence insertion efficiency and built a model to predict insertion rates based on the insert sequence. This helps users to choose optimal contructs for DNA insertion with prime editing.

The provided model "MinsePIE.sav" was trained on 22974 events: a libary of 2,666 insert sequences up to 69 nt in length in four genomic sites (CLYBL, EMX1, FANCF, HEK3) in three human cell lines, using the PE2 prime editing system.

System requirements

If you encounter problems setting up the environment or packages, please check out the detailed description for installing the packages in the scripts folder.

Usage guide

The MinsePIE tools are constantly improving. Therefore, it is recommended to run clone the github repository and update it frequently:

# clone
git clone https://github.com/julianeweller/MinsePIE.git
# update
git pull
# install MinsePIE: go into the folder with setup.py
pip install .

Here is an example on how to use minsepie in python:

import minsepie
minsepie.predict(['TGTCA'], pbs = 'CAGACTGAGCACG', ha = 'TGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCA', spacer = 'GGCCCAGACTGAGCACGTGA', mmr = 0, outdir = "./")

Python API

###Prediction minsepie.predict(insert, fasta = None, pbs = None, ha = None, spacer = None, halen = 15, pbslen = 13, spclen = 20, mmr = 0, inputmode = None, cellline = None, outdir = None, mean = None, std = None, model = None) \n

Predicts editing outcomes for insert sequences based on pegRNA features given individually or determined from fasta sequence. Provide either fasta (with optionally rttlen, pbslen, spclen) or pbs + rtt + spacer.

Parameter Type Description
insert list Insert sequences to be tested
fasta file Fasta file with target sequences
pbs str Primer binding site sequence for the pegRNA
ha str Homology arm for reverse transcriptase template covering the homology sequence. This does not include the new sequence to be inserted
spacer str pegRNA spacer
halen int Length of the RTT. Only needed if target site is provided as fasta.
pbslen int Length of the PBS. Only needed if target site is provided as fasta.
spclen int Length of the spacer. Only needed if target site is provided as fasta.
mmr int Mismatch repair proficiency of cell line. 0: MMR deficient. 1: MMR proficient
Inputmode “dna”, “protein”, or None Insert sequence can either be nucleotides or amino acids. If none, default is DNA.
cellline str, None Instead of providing the MMR status directly, cell line can be provided and MMR status is determined based on reference file.
outdir dir Output directory
mean int, None Expected mean editing rate for the prime editing screen used to scale the z-factor to an insertion rate.
std int, None Expected standard deviation for the prime editing screen used to scale the z-factor to an insertion rate.
model str, None Model used to predict editing efficiency.

Returns request as dataframe with features and prediction

Example:

predict([“TGTCA”], pbs = “CAGACTGAGCACG”, rtt = “TGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCA”, spacer = “GGCCCAGACTGAGCACGTGA”, mmr = 0)

Reference

Predicting efficiency of writing short sequences into the genome using prime editing
Jonas Koeppel, Elin Madli Peets, Juliane Weller, Ananth Pallaseni, Fabio Liberante, Leopold Parts
bioRxiv https://www.biorxiv.org/content/10.1101/2021.11.10.468024v1
doi: https://doi.org/10.1101/2021.11.10.468024

minsepiesad-sys's People

Contributors

julianeweller avatar fabiolib avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.