sguizard / densitymap Goto Github PK
View Code? Open in Web Editor NEWDensityMap is perl tool for the visualization of features density along chromosomes
License: GNU General Public License v3.0
densitymap's People
Contributors
Stargazers
Watchers
densitymap's Issues
Usage
Hi. I really like your tool, just one small issue with the usage example returned when -help is used.
USAGE: DensityMap.pl -gff chromosome.gff3 -ty 'match=all' -o Chromosome
Shouldn't the -gff be -i for input?
Cheers
results not matching data and changing the -sc not working
The dmel example command works so your code is apparently OK
BUT
I have no results with my data and the default (1kb) while the data supports counts; additionally, I added -sc 100 but the csv file is still showing 1kb intervals.
I suspected a parsing problem due to maybe the pipes in my scaffold names and changed the pipes| to _ without improvement. I also added 1 to the end coordinate to not have 0-length and no better.
I am lost! my columns match your dme demo file which works out ...
Does the content of the last field matter? what is counted by Density, the footprint (base number) on the chromosome or the number of rows intersecting the interval?
DensityMap.pl -i motifs.gff -o F1_modified_base.svg -ty "modified_base=fused" -sc 100
# head of the csv
sequence feature start end density
000029F|arrow modified_base 0 1000 0
000029F|arrow modified_base 1000 2000 0
000029F|arrow modified_base 2000 3000 0
000029F|arrow modified_base 3000 4000 0
000029F|arrow modified_base 4000 5000 0
000029F|arrow modified_base 5000 6000 0
000029F|arrow modified_base 6000 7000 0
000029F|arrow modified_base 7000 8000 0
000029F|arrow modified_base 8000 9000 0
The input data
##gff-version 3
##source ipdSummary v2.0
##sequence-region 000029F|arrow 1 156279
000029F|arrow kinModCall modified_base 5719 5719 42 + . coverage=33;context=TATCATGCCCTTGAAAATTCTTCTGGCAACAAAACAACACG;IPDRatio=3.49
000029F|arrow kinModCall modified_base 7070 7070 32 + . coverage=44;context=AAGTTGAAAAGAATCAACGAACTTAACAATAAACTGAGGAA;IPDRatio=2.63
000029F|arrow kinModCall modified_base 7233 7233 33 + . coverage=46;context=ATTTTATAGAGGGTTTGAAAAATGCTCAAAAAAATAGCCAA;IPDRatio=2.81
000029F|arrow kinModCall modified_base 7435 7435 31 + . coverage=42;context=CGGTAATCTTATCTTTATTGTTAGACTTCGCAGAAATTTCC;IPDRatio=2.55
000029F|arrow kinModCall modified_base 7440 7440 31 - . coverage=35;context=CTAAAGGAAATTTCTGCGAAGTCTAACAATAAAGATAAGAT;IPDRatio=2.90
000029F|arrow kinModCall modified_base 7540 7540 42 - . coverage=38;context=TAGCGAACTATACCTAAAAGGGTGGGCATTGGTTAACATTA;IPDRatio=2.76
000029F|arrow kinModCall modified_base 8239 8239 32 - . coverage=36;context=GGATTTGGTTAGAGAAAAGCTCTTGACAATTATGAATACCA;IPDRatio=3.09
000029F|arrow kinModCall modified_base 8259 8259 31 + . coverage=49;context=AGCTTTTCTCTAACCAAATCCTTCAACATTGTTTTATCTAC;IPDRatio=2.47
000029F|arrow kinModCall modified_base 8405 8405 31 - . coverage=40;context=AACTGTTAATCTTCGTATCGAGTGATGTGTTAGAAGCGTTG;IPDRatio=2.90
000029F|arrow kinModCall modified_base 8560 8560 36 + . coverage=46;context=TGAAAGCCTAGCTAAAGTTCTCTGGTCGTGCAACATTCGAG;IPDRatio=3.86
Any idea what is wrong with my analysis?
Thanks
failed to read FASTA file
Hi,
I uploaded my fasta file in order to calculate GC content. But DensityMap could not find where it is since an error popped out:
`Use of uninitialized value in numeric gt (>) at
/group/pawsey0263/yguo/Anaconda3/bin/DensityMap.pl line 171 (#1)
(W uninitialized) An undefined value was used as if it were already
defined. It was interpreted as a "" or a 0, but maybe it was a mistake.
To suppress this warning assign a defined value to your variables.
To help you figure out what was undefined, perl will try to tell you
the name of the variable (if any) that was undefined. In some cases
it cannot do this, so it also tells you what operation you used the
undefined value in. Note, however, that perl optimizes your program
and the operation displayed in the warning may not necessarily appear
literally in your program. For example, "that $foo" is usually
optimized into "that " . $foo, and the warning will refer to the
concatenation (.) operator, even though there is no . in
your program.`
I followed the format as instructed in the dmel example. Could you please help me solve this issue?
Regards
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.