Giter VIP home page Giter VIP logo

qfilt's Introduction

qfilt

This simple program is meant to filter sequencing data, optionally removing or splitting reads with poor quality scores and to optionally only retain fragments from reads that are tagged with a given 5' sequence.

BUILD & INSTALL

The build process requires CMake. To build, type:

cmake [-DINSTALL_PREFIX=/install/path (default=/usr/local)] .
make install

USAGE

qfilt [-h] [-v] [-o OUTPUT] [-q QSCORE] [-l LENGTH] [-m MODE] [-T PREFIX] [-t MISMATCH] (-F FASTQ | -Q FASTA QUAL)

To try it using the example data provided:

qfilt -F data/test.fna data/test.qual -q 15 -l 30 -T ATATCGCGAGGA

OUTPUT:

stderr:

run settings:
	input fasta:         data/test.fna
	input qual:          data/test.qual
	min q-score:         15
	min fragment length: 30
	run mode:            0 (truncate/don't tolerate homopolymers/don't tolerate ambigs)
	5' tag:              ATATCGCGAGGA
	max tag mismatches:  0

run summary:
	total bases       :  29570
	original reads    :  305
	q10               :  0.995502
	q20               :  0.860298
	q30               :  0.728745
	mean q-score      :  33.2273
	contributing reads:  5
	retained fragments:  5

original read length distribution:
	mean:                96.9508
	median:              77
	variance             3743.03
	standard deviation:  61.1803
	min:                 49
	2.5%:                54
	97.5%:               332
	max:                 497

retained fragment length distribution:
	mean:                41
	median:              37
	variance             72.5
	standard deviation:  8.51469
	min:                 33
	2.5%:                33
	97.5%:               54
	max:                 54

stdout:

>GM98SRO01B77KU rank=0000671 x=796.0 y=1996.0 length=58
CCACGCGTATCGATGTCGACTTTTTTTTCTTTTCTTACATAGTAG
>GM98SRO01BA3RP rank=0000953 x=419.5 y=1603.5 length=87
CTGATGCTGCACCAACTGTACTCCCTCGCGATA
>GM98SRO01E1BKW rank=0001233 x=1948.0 y=846.0 length=66
TACAGTTGGTGCAGCATCAGAAAAGTACGACATCGATACGCGTGGTCCTCGCGA
>GM98SRO01DVVNY rank=0001304 x=1476.0 y=636.5 length=84
ACGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA
>GM98SRO01D6FIX rank=0001416 x=1596.0 y=1415.0 length=91
CGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA

ARGUMENTS

optional arguments:
-h, --help               show this help message and exit
-v, --version            show version and exit
-o OUTPUT                direct retained fragments to a file named OUTPUT (default=stdout)
-q QSCORE                minimum per-base quality score below which a read will be split
                         or truncated (default=20)
-l LENGTH                minimum retained fragment LENGTH (default=50)
-m MODE                  MODE is a 3-bitmask (an integer in [0-7], default=0):
                         if the lowest bit is set, it is like passing -s;
                         if the middle bit is set, it is like passing -p;
                         and if the highest bit is set, it is like passing -a
-s                       when encountering a low q-score, split instead of truncate
-p                       tolerate low q-score homopolymeric regions
-a                       tolerate low q-score ambiguous nucleotides
-T PREFIX                if supplied, only reads with this PREFIX are retained,
                         and the PREFIX is stripped from each contributing read
-t MISMATCH              if PREFIX is supplied, prefix matching tolerates at most
                         MISMATCH mismatches (default=0)
-f FORMAT                output in FASTA or FASTQ format (default=FASTA)
-j                       output run diagnostics to stderr as JSON (default is to write ASCII text)

qfilt's People

Contributors

nlhepler avatar spond avatar stevenweaver avatar

Watchers

 avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.