Giter VIP home page Giter VIP logo

bindit's Introduction

BindIt

A small tool for searching many genome sequences for possible binding site sequence templates

Biologists looking for specific subsequence templates in large gene sequence data files often do so visually. Finding many occurences of these certain sequences in a gene may lead to faster experimentation.

Bindit is a simple tool where researchers may specify datafiles and templates for potential subsequences that may occur in the data and can search the data for matches on these templates computationally.

Example

A researcher hypothesizes that binding sites for a process may occur on certain genes with the following generic nucleotide sequence:

TCTG[0-4 of any character]CAGA

and the gene sequence data is thousands of lines of:

GTGGAGTGCTGAGGGACTCTGCCTCCAACGTCACCACCATCCACACCCCGGACACCCAGTGATGGGGGAGGATGGCACAGTGGTCAAGAGCACAGACTCTAGAGACTGTCAGAGCTGACCCCAGCTAAGGCATGGCACCGCT

Instead of searching by hand, they may instead specify the generic sequence as a list of subsequences:

TCTG,4,CAGA

BindIt will take this sequence, convert it to the appropriate regular expression and search all of the data for occurences matching this template.

###TODO:

  • Breakdown of where matched sequences occured in the gene
  • Print out how many matches in first 800 and after
  • Match 1-edit-distance permutations of sequence templates, Only one wild card per entire sequence at a time
  • Compatibility with filetypes other than docx
  • Bindings to enumberable to eliminate the need for data in file form

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.