Giter VIP home page Giter VIP logo

kmercount's Introduction

Kmercount

Kmercount (kmercount) is a simple command line tool to quickly count the number of occurences of a set of selected kmers in a set of sequences. A k-mer is defined as a continuous sequence of k nucleotides. Kmercount will work with kmers of up to 32 nucleotides.

Kmercount uses an efficient hash function, Bloom filter and hash table to perform the counting rapidly.

Compilation and installation

The code is C++11 standard compliant and should compile easily using make and a modern C++ compiler (e.g. GNU GCC or LLVM Clang). Run make clean, make, make install in the main folder to clean, build, and install the tool. There are no dependencies except for the C and C++ standard libraries.

General options

Here are the Kmercount options:

Kmercount 0.0.2

Usage: kmercount [OPTIONS] KMERFILENAME [SEQUENCEFILENAME]

General options:
 -h, --help                 display this help and exit
 -k, --kmer-length INTEGER  kmer length [1-32] (31)
 -t, --threads INTEGER      number of threads to use [1-1] (1)
 -v, --version              display version information and exit

Input/output options:
 -l, --log FILENAME         log to file (stderr)
 -o, --output FILENAME      output result to file (stdout)

Use the -h or --help option to show some help information.

Run the program with -v or --version for version information.

The input file with the selected kmers must be specified as the first positional argument. It must be a FASTA formatted file with sequences of the correct length (k). The FASTA headers are ignored.

The input file with the sequences to scan for kmers may be specified as the second postional argument. If not specified, or specified as -, the program will read from standard input. The input must be in FASTA format. The headers are ignored.

The kmer length may be specified with the -k or --kmerlength option. The length must be in the range from 1 to 32. The default kmer length is 31.

The number of parallel threads requested may be specified with the -t or --threads option. However, the code is not multi-threaded, yet.

While the program is running it will print some status and progress information to standard error (stderr) unless a log file has been specified with the -l or --log option. Error messages and warnings will also be written here.

The results will be written to standard output (stdout) unless a file name has been specified with the -o or --output option. The output is a plain text file with tab-separated values. The first column contains the kmer sequences, while the second column contains the counts. The kmers are sorted by descending number of occurences.

General information

All input sequences must be nucleotide sequences. The letters ACGTNacgtn are accepted, but be aware that N and n are treated as A.

The kmer sequences should be distinct. The number of distinct (unique) kmers will be shown.

Example

Command line:

kmercount -k 31 -o counts.tsv kmers.fasta seq.fasta

The kmers.fasta file:

>kmer1
AAGAAATGAGAAGTAATCAGAAAACCACTTA
>kmer2
AGAAATGAGAAGTAATCAGAAAACCACTTAA
>kmer3
GAAATGAGAAGTAATCAGAAAACCACTTAAG
>kmer4
AAATGAGAAGTAATCAGAAAACCACTTAAGG

The seq.fasta file:

>seq
AAGAAATGAGAAGTAATCAGAAAACCACTTAAGG

Output to terminal:

Kmercount 0.0.2

Kmer file:         kmers.fasta
Sequence file:     seq.fasta
Kmer length:       31
Output file:       counts.tsv
Threads:           1

Reading kmer file
Reading sequences: 100%  
Indexing database: 100% 
Database info:     124 nt in 4 sequences, longest 31 nt
Indexing kmers:    100% 
Unique kmers:      4

Reading sequence file
Reading sequences: 100%  
Indexing database: 100%
Database info:     34 nt in 1 sequences, longest 34 nt
Counting matches:  100%  

Sorting results:   100%
Writing results:   100% 
Matching kmers:    4
Total matches:     4

Output to counts.tsv (only first 10 lines shown):

AAATGAGAAGTAATCAGAAAACCACTTAAGG	1
AGAAATGAGAAGTAATCAGAAAACCACTTAA	1
AAGAAATGAGAAGTAATCAGAAAACCACTTA	1
GAAATGAGAAGTAATCAGAAAACCACTTAAG	1

kmercount's People

Contributors

torognes avatar

Stargazers

Shuai Chen avatar Jianshu_Zhao avatar

Watchers

sandve avatar  avatar Milena Pavlovic avatar Jianshu_Zhao avatar

Forkers

torognes

kmercount's Issues

Reverse bit order?

Reverse bit order of kmers so that two kmers can be compared numerically and give the expected result (alphabetically).

a ruby based version of kmer iterations and kmer graph preparation

def kmers(sequence, kmer)
=BEGIN
#!/usr/bin/ruby
#Universitat Potsdam
#Date: 2024-3-15
#Author: Gaurav Sablok
=END
seqsplitter = sequence.split(//)
kmeriter = kmer.to_i
seqkmers = []
for i in 0..seqsplitter.length-kmeriter
seqkmers.push(seqsplitter.slice(i,i-i+kmeriter).join)
end
return seqkmers.each { | iter | puts iter.to_s + "\t" + seqkmers.count(iter).to_s }
end

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.