bzhanglab / neoflow Goto Github PK

View Code? Open in Web Editor NEW

20.0 5.0 12.0 4.1 MB

NeoFlow: a proteogenomics pipeline for neoantigen discovery

Nextflow 49.51% Python 32.70% R 17.79%

novel-peptide-identifications neoantigen-prediction neoantigen-discovery proteogenomics nextflow-pipeline

neoflow's People

Contributors

Stargazers

Watchers

Forkers

ypriverol kailicn caosgc33d jokendo-collab animesh xiaobo199405 zhuchcn twobrassiere rnaimehaom parthomayo xia1yang

neoflow's Issues

Exception in thread "Task submitter" java.lang.NumberFormatException: For input string: "null"

I tried to use neoflow by exampledata.But I get an error when I run neoflow_msms.nf
this is my code
./nextflow run ./neoflow-master/neoflow_msms.nf \ --ms /mnt/g/example_data/mgf \ --msms_para_file /mnt/g/example_data/comet_parameter.txt \ --search_engine comet --db ./test/customized_database/neoflow_crc_target_decoy.fasta --out_dir test2 \ --pv_refdb ./test/customized_database/ref.fasta --pv_tol 20 --pv_itol 0.05

then I get the following erros:

N E X T F L O W ~ version 21.10.6 Launching./neoflow-master/neoflow_msms.nf[reverent_watson] - revision: 9f41504eb3 Process multiple MS/MS files. [- ] process > msms_searching - [- ] process > calculate_fdr - [- ] process > prepare_pepquery_input - [- ] process > run_pepquery - [- ] process > add_pepquery_validation - WARN: Access to undefined parametercpu-- Initialise it to a default value eg.params.cpu = some_value`
Error executing process > 'msms_searching (spec-00565.mgf)'

Caused by:
For input string: "null"

Exception in thread "Task submitter" java.lang.NumberFormatException: For input string: "null"
at java.lang.NumberFormatException.forInputString(NumberFormatException.java:65)
at java.lang.Integer.parseInt(Integer.java:580)
at java.lang.Integer.valueOf(Integer.java:766)
at org.codehaus.groovy.runtime.StringGroovyMethods.toInteger(StringGroovyMethods.java:3134)
at org.codehaus.groovy.runtime.StringGroovyMethods.asType(StringGroovyMethods.java:192)
at nextflow.extension.Bolts.asType(Bolts.groovy:449)
at sun.reflect.GeneratedMethodAccessor12.invoke(Unknown Source)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:498)
at org.codehaus.groovy.runtime.metaclass.ReflectionMetaMethod.invoke(ReflectionMetaMethod.java:54)
at org.codehaus.groovy.runtime.metaclass.NewInstanceMetaMethod.invoke(NewInstanceMetaMethod.java:54)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:323)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1268)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1035)
at org.codehaus.groovy.runtime.InvokerHelper.invokePojoMethod(InvokerHelper.java:1017)
at org.codehaus.groovy.runtime.InvokerHelper.invokeMethod(InvokerHelper.java:1008)
at org.codehaus.groovy.runtime.ScriptBytecodeAdapter.invokeMethodN(ScriptBytecodeAdapter.java:180)
at org.codehaus.groovy.runtime.ScriptBytecodeAdapter.asType(ScriptBytecodeAdapter.java:603)
at nextflow.processor.TaskConfig.getCpus(TaskConfig.groovy:282)
at nextflow.processor.TaskConfig$getCpus$18.call(Unknown Source)
at nextflow.processor.TaskHandler.getTraceRecord(TaskHandler.groovy:168)
at nextflow.executor.LocalTaskHandler.super$2$getTraceRecord(LocalExecutor.groovy)
at sun.reflect.GeneratedMethodAccessor336.invoke(Unknown Source)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:498)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:107)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:323)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1268)
at org.codehaus.groovy.runtime.ScriptBytecodeAdapter.invokeMethodOnSuperN(ScriptBytecodeAdapter.java:144)
at org.codehaus.groovy.runtime.ScriptBytecodeAdapter.invokeMethodOnSuper0(ScriptBytecodeAdapter.java:164)
at nextflow.executor.LocalTaskHandler.getTraceRecord(LocalExecutor.groovy:256)
at nextflow.Session.notifyTaskComplete(Session.groovy:972)
at nextflow.processor.TaskPollingMonitor.submitPendingTasks(TaskPollingMonitor.groovy:566)
at nextflow.processor.TaskPollingMonitor.submitLoop(TaskPollingMonitor.groovy:387)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
[- ] process > msms_searching -
[- ] process > calculate_fdr -
[- ] process > prepare_pepquery_input -
[- ] process > run_pepquery -
[- ] process > add_pepquery_validation -
WARN: Access to undefined parameter cpu -- Initialise it to a default value eg. params.cpu = some_value
Error executing process > 'msms_searching (spec-00565.mgf)'

Caused by:
For input string: "null"
`
Is there some one can help me? thank you very much!

Error with demo data when running STEP2

I copied test data from example_data folder provided by the neoflow.
the input_vcf_list.txt file looks like:

experiment      sample  file    file_type
crc_test        sample1 /neoantigen2/input/sample1.vcf   somatic

the copied sample1.vcf looks like:

##fileformat=VCFv4.2
##contig=<ID=chrM,length=16571,assembly=hg19>
##contig=<ID=chr1,length=249250621,assembly=hg19>
##contig=<ID=chr2,length=243199373,assembly=hg19>
##contig=<ID=chr3,length=198022430,assembly=hg19>
##contig=<ID=chr4,length=191154276,assembly=hg19>
##contig=<ID=chr5,length=180915260,assembly=hg19>
##contig=<ID=chr6,length=171115067,assembly=hg19>
##contig=<ID=chr7,length=159138663,assembly=hg19>
##contig=<ID=chr8,length=146364022,assembly=hg19>
##contig=<ID=chr9,length=141213431,assembly=hg19>
##contig=<ID=chr10,length=135534747,assembly=hg19>
##contig=<ID=chr11,length=135006516,assembly=hg19>
##contig=<ID=chr12,length=133851895,assembly=hg19>
##contig=<ID=chr13,length=115169878,assembly=hg19>
##contig=<ID=chr14,length=107349540,assembly=hg19>
##contig=<ID=chr15,length=102531392,assembly=hg19>
##contig=<ID=chr16,length=90354753,assembly=hg19>
##contig=<ID=chr17,length=81195210,assembly=hg19>
##contig=<ID=chr18,length=78077248,assembly=hg19>
##contig=<ID=chr19,length=59128983,assembly=hg19>
##contig=<ID=chr20,length=63025520,assembly=hg19>
##contig=<ID=chr21,length=48129895,assembly=hg19>
##contig=<ID=chr22,length=51304566,assembly=hg19>
##contig=<ID=chrX,length=155270560,assembly=hg19>
##contig=<ID=chrY,length=59373566,assembly=hg19>
##contig=<ID=chr1_gl000191_random,length=106433,assembly=hg19>
##contig=<ID=chr1_gl000192_random,length=547496,assembly=hg19>
##contig=<ID=chr4_gl000193_random,length=189789,assembly=hg19>
##contig=<ID=chr4_gl000194_random,length=191469,assembly=hg19>
##contig=<ID=chr6_cox_hap2,length=4795371,assembly=hg19>
##contig=<ID=chr7_gl000195_random,length=182896,assembly=hg19>
##contig=<ID=chr9_gl000198_random,length=90085,assembly=hg19>
##contig=<ID=chr9_gl000199_random,length=169874,assembly=hg19>
##contig=<ID=chr17_gl000205_random,length=174588,assembly=hg19>
##contig=<ID=chr19_gl000208_random,length=92689,assembly=hg19>
##contig=<ID=chr19_gl000209_random,length=159169,assembly=hg19>
##contig=<ID=chrUn_gl000211,length=166566,assembly=hg19>
##contig=<ID=chrUn_gl000212,length=186858,assembly=hg19>
##contig=<ID=chrUn_gl000213,length=164239,assembly=hg19>
##contig=<ID=chrUn_gl000214,length=137718,assembly=hg19>
##contig=<ID=chrUn_gl000215,length=172545,assembly=hg19>
##contig=<ID=chrUn_gl000216,length=172294,assembly=hg19>
##contig=<ID=chrUn_gl000217,length=172149,assembly=hg19>
##contig=<ID=chrUn_gl000218,length=161147,assembly=hg19>
##contig=<ID=chrUn_gl000219,length=179198,assembly=hg19>
##contig=<ID=chrUn_gl000220,length=161802,assembly=hg19>
##contig=<ID=chrUn_gl000221,length=155397,assembly=hg19>
##contig=<ID=chrUn_gl000222,length=186861,assembly=hg19>
##contig=<ID=chrUn_gl000224,length=179693,assembly=hg19>
##contig=<ID=chrUn_gl000225,length=211173,assembly=hg19>
##contig=<ID=chrUn_gl000226,length=15008,assembly=hg19>
##contig=<ID=chrUn_gl000228,length=129120,assembly=hg19>
##contig=<ID=chrUn_gl000229,length=19913,assembly=hg19>
##contig=<ID=chrUn_gl000230,length=43691,assembly=hg19>
##contig=<ID=chrUn_gl000231,length=27386,assembly=hg19>
##contig=<ID=chrUn_gl000232,length=40652,assembly=hg19>
##contig=<ID=chrUn_gl000234,length=40531,assembly=hg19>
##contig=<ID=chrUn_gl000236,length=41934,assembly=hg19>
##contig=<ID=chrUn_gl000237,length=45867,assembly=hg19>
##contig=<ID=chrUn_gl000238,length=39939,assembly=hg19>
##contig=<ID=chrUn_gl000239,length=33824,assembly=hg19>
##contig=<ID=chrUn_gl000240,length=41933,assembly=hg19>
##contig=<ID=chrUn_gl000241,length=42152,assembly=hg19>
##contig=<ID=chrUn_gl000243,length=43341,assembly=hg19>
##reference=file:///data/kail/tmp/nxf.ovMAqCSHCz/ucsc.hg19.fasta
#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	crc_cell_lines
chrM	73	.	G	A	207.78	PASS	.	GT:AD:DP:GQ:PL	1/1:0,9:9:27:236,27,0
chrM	150	.	T	C	85.28	PASS	.	GT:AD:DP:GQ:PL	1/1:0,3:3:9:113,9,0
chrM	410	.	A	T	169.84	PASS	.	GT:AD:DP:GQ:PL	1/1:0,6:6:18:198,18,0
chrM	515	.	GCA	G	83.25	PASS	.	GT:AD:DP:GQ:PL	1/1:0,3:3:9:120,9,0
chrM	2354	.	C	T	57.28	PASS	.	GT:AD:DP:GQ:PL	1/1:0,3:3:9:85,9,0
chrM	2708	.	G	A	126.9	PASS	.	GT:AD:DP:GQ:PL	1/1:0,5:5:15:155,15,0
chrM	16364	.	T	C	241.84	PASS	.	GT:AD:DP:GQ:PL	1/1:0,6:6:18:270,18,0
chr1	13868	.	A	G	72.77	PASS	.	GT:AD:DP:GQ:PL	0/1:16,6:22:99:101,0,367
chr1	13896	rs201696125	C	A	50.77	PASS	.	GT:AD:DP:GQ:PL	0/1:14,5:19:79:79,0,340
chr1	14907	rs79585140	A	G	919.77	PASS	.	GT:AD:DP:GQ:PL	0/1:20,38:58:99:948,0,429
chr1	14930	rs75454623	A	G	878.77	PASS	.	GT:AD:DP:GQ:PL	0/1:16,34:50:99:907,0,341
chr1	15274	rs201931625	A	T	62.28	PASS	.	GT:AD:DP:GQ:PL	1/1:0,3:3:9:90,9,0
chr1	16495	rs141130360	G	C	41.77	PASS	.	GT:AD:DP:GQ:PL	0/1:14,5:19:70:70,0,395
chr1	16534	rs201459529	C	T	298.77	PASS	.	GT:AD:DP:GQ:PL	0/1:5,15:20:67:327,0,67
chr1	16571	rs199676946	G	A	188.77	PASS	.	GT:AD:DP:GQ:PL	0/1:4,10:14:61:217,0,61
chr1	1453304	rs141065088	C	T	40.74	PASS	.	GT:AD:DP:GQ:PL	1/1:0,2:2:6:68,6,0
chr1	1454519	rs370448805	G	C	51.77	PASS	.	GT:AD:DP:GQ:PL	0/1:2,3:5:63:80,0,63
chr1	3427514	rs146093263	GCACACGCCCCCACC	G	98.25	PASS	.	GT:AD:DP:GQ:PL	1/1:0,3:3:9:135,9,0
chr1	3428160	rs2820999	T	G	215.8	PASS	.	GT:AD:DP:GQ:PL	1/1:0,7:7:21:244,21,0
chr1	3496479	rs2794340	T	C	33.77	PASS	.	GT:AD:DP:GQ:PL	0/1:2,2:4:62:62,0,64
chr1	3545175	rs147637374	GTTCTGGGAGCTCCTCCCCC	G	151.82	PASS	.	GT:AD:DP:GQ:PL	1/1:0,4:4:17:189,17,0
chr1	3546264	rs137965653	CCGGG	C	277.77	PASS	.	GT:AD:DP:GQ:PL	1/1:0,7:7:21:315,21,0
chr1	59147926	rs12139511	T	C	769.77	PASS	.	GT:AD:DP:GQ:PL	1/1:0,22:22:66:798,66,0
chr1	59148118	rs17118103	A	T	280.77	PASS	.	GT:AD:DP:GQ:PL	0/1:8,10:18:99:309,0,173
chr1	59150941	rs2206764	G	A	396.77	PASS	.	GT:AD:DP:GQ:PL	1/1:0,13:13:39:425,39,0
chr1	59150997	rs5774421	TA	T	88.87	PASS	.	GT:AD:DP:GQ:PL	1/1:0,5:5:15:126,15,0
chr1	59156155	rs12076049	C	T	200.84	PASS	.	GT:AD:DP:GQ:PL	1/1:0,6:6:18:229,18,0
chr1	59158632	rs12097333	T	C	584.77	PASS	.	GT:AD:DP:GQ:PL	1/1:0,18:18:54:613,54,0
chr1	59160724	rs66629118	TA	T	63.0	PASS	.	GT:AD:DP:GQ:PL	1/1:0,4:4:12:100,12,0
chr1	59248813	rs2760499	G	C	292.77	PASS	.	GT:AD:DP:GQ:PL	1/1:0,11:11:33:321,33,0
...(etc, 81914 lines in total)

I can run through STEP2 using these 2 files.

(base) [root@gpu01 neoantigen2]# sh test_cmd.sh 
N E X T F L O W  ~  version 21.04.3
Launching `./neoflow_db.nf` [compassionate_jennings] - revision: 421847b8f4
Format input mapping file: /neoantigen2/input/test_vcf_files.tsv!
New mapping file: output/test_vcf_files.tsv!
executor >  local (5)
[7c/318276] process > pre_processing (test_vcf_files.tsv)            [100%] 1 of 1 ✔
[87/d3b425] process > variant_annotation (crc_test-mapping_file.tsv) [100%] 1 of 1 ✔
[62/9f2138] process > database_construction (crc_test)               [100%] 1 of 1 ✔
[dd/0d806c] process > format_db (crc_test)                           [100%] 1 of 1 ✔
[05/178767] process > generate_decoy_db (crc_test)                   [100%] 1 of 1 ✔
Completed at: 19-Jan-2022 05:12:16
Duration    : 12m 59s
CPU hours   : 0.2
Succeeded   : 5


crc_test
N E X T F L O W  ~  version 21.04.3
Launching `./neoflow_msms.nf` [dreamy_borg] - revision: 5cf4143baf
Process multiple MS/MS files.
executor >  local (19)
[2b/f3de6e] process > msms_searching (spec-00037.mgf)                   [100%] 15 of 15 ✔
[d6/3db5c3] process > calculate_fdr (calculate_fdr)                     [100%] 1 of 1 ✔
[ab/67eada] process > prepare_pepquery_input (prepare_pepquery_input)   [100%] 1 of 1 ✔
[47/b207b0] process > run_pepquery (run_pepquery)                       [100%] 1 of 1 ✔
[3c/c1bbee] process > add_pepquery_validation (add_pepquery_validation) [100%] 1 of 1 ✔
Completed at: 19-Jan-2022 06:14:34
Duration    : 1h 2m 11s
CPU hours   : 11.0
Succeeded   : 19

but when I randomly sample 7191 vcf records from sample1.vcf before running the same pipeline,
it is exactly the same as the last one except for the number of rows.
this time the input vcf file looks like:

##fileformat=VCFv4.2
##contig=<ID=chrM,length=16571,assembly=hg19>
##contig=<ID=chr1,length=249250621,assembly=hg19>
##contig=<ID=chr2,length=243199373,assembly=hg19>
##contig=<ID=chr3,length=198022430,assembly=hg19>
##contig=<ID=chr4,length=191154276,assembly=hg19>
##contig=<ID=chr5,length=180915260,assembly=hg19>
##contig=<ID=chr6,length=171115067,assembly=hg19>
##contig=<ID=chr7,length=159138663,assembly=hg19>
##contig=<ID=chr8,length=146364022,assembly=hg19>
##contig=<ID=chr9,length=141213431,assembly=hg19>
##contig=<ID=chr10,length=135534747,assembly=hg19>
##contig=<ID=chr11,length=135006516,assembly=hg19>
##contig=<ID=chr12,length=133851895,assembly=hg19>
##contig=<ID=chr13,length=115169878,assembly=hg19>
##contig=<ID=chr14,length=107349540,assembly=hg19>
##contig=<ID=chr15,length=102531392,assembly=hg19>
##contig=<ID=chr16,length=90354753,assembly=hg19>
##contig=<ID=chr17,length=81195210,assembly=hg19>
##contig=<ID=chr18,length=78077248,assembly=hg19>
##contig=<ID=chr19,length=59128983,assembly=hg19>
##contig=<ID=chr20,length=63025520,assembly=hg19>
##contig=<ID=chr21,length=48129895,assembly=hg19>
##contig=<ID=chr22,length=51304566,assembly=hg19>
##contig=<ID=chrX,length=155270560,assembly=hg19>
##contig=<ID=chrY,length=59373566,assembly=hg19>
##contig=<ID=chr1_gl000191_random,length=106433,assembly=hg19>
##contig=<ID=chr1_gl000192_random,length=547496,assembly=hg19>
##contig=<ID=chr4_gl000193_random,length=189789,assembly=hg19>
##contig=<ID=chr4_gl000194_random,length=191469,assembly=hg19>
##contig=<ID=chr6_cox_hap2,length=4795371,assembly=hg19>
##contig=<ID=chr7_gl000195_random,length=182896,assembly=hg19>
##contig=<ID=chr9_gl000198_random,length=90085,assembly=hg19>
##contig=<ID=chr9_gl000199_random,length=169874,assembly=hg19>
##contig=<ID=chr17_gl000205_random,length=174588,assembly=hg19>
##contig=<ID=chr19_gl000208_random,length=92689,assembly=hg19>
##contig=<ID=chr19_gl000209_random,length=159169,assembly=hg19>
##contig=<ID=chrUn_gl000211,length=166566,assembly=hg19>
##contig=<ID=chrUn_gl000212,length=186858,assembly=hg19>
##contig=<ID=chrUn_gl000213,length=164239,assembly=hg19>
##contig=<ID=chrUn_gl000214,length=137718,assembly=hg19>
##contig=<ID=chrUn_gl000215,length=172545,assembly=hg19>
##contig=<ID=chrUn_gl000216,length=172294,assembly=hg19>
##contig=<ID=chrUn_gl000217,length=172149,assembly=hg19>
##contig=<ID=chrUn_gl000218,length=161147,assembly=hg19>
##contig=<ID=chrUn_gl000219,length=179198,assembly=hg19>
##contig=<ID=chrUn_gl000220,length=161802,assembly=hg19>
##contig=<ID=chrUn_gl000221,length=155397,assembly=hg19>
##contig=<ID=chrUn_gl000222,length=186861,assembly=hg19>
##contig=<ID=chrUn_gl000224,length=179693,assembly=hg19>
##contig=<ID=chrUn_gl000225,length=211173,assembly=hg19>
##contig=<ID=chrUn_gl000226,length=15008,assembly=hg19>
##contig=<ID=chrUn_gl000228,length=129120,assembly=hg19>
##contig=<ID=chrUn_gl000229,length=19913,assembly=hg19>
##contig=<ID=chrUn_gl000230,length=43691,assembly=hg19>
##contig=<ID=chrUn_gl000231,length=27386,assembly=hg19>
##contig=<ID=chrUn_gl000232,length=40652,assembly=hg19>
##contig=<ID=chrUn_gl000234,length=40531,assembly=hg19>
##contig=<ID=chrUn_gl000236,length=41934,assembly=hg19>
##contig=<ID=chrUn_gl000237,length=45867,assembly=hg19>
##contig=<ID=chrUn_gl000238,length=39939,assembly=hg19>
##contig=<ID=chrUn_gl000239,length=33824,assembly=hg19>
##contig=<ID=chrUn_gl000240,length=41933,assembly=hg19>
##contig=<ID=chrUn_gl000241,length=42152,assembly=hg19>
##contig=<ID=chrUn_gl000243,length=43341,assembly=hg19>
##reference=file:///data/kail/tmp/nxf.ovMAqCSHCz/ucsc.hg19.fasta
#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	crc_cell_lines
chrM	73	.	G	A	207.78	PASS	.	GT:AD:DP:GQ:PL	1/1:0,9:9:27:236,27,0
chrM	150	.	T	C	85.28	PASS	.	GT:AD:DP:GQ:PL	1/1:0,3:3:9:113,9,0
chrM	410	.	A	T	169.84	PASS	.	GT:AD:DP:GQ:PL	1/1:0,6:6:18:198,18,0
chrM	515	.	GCA	G	83.25	PASS	.	GT:AD:DP:GQ:PL	1/1:0,3:3:9:120,9,0
chrM	2354	.	C	T	57.28	PASS	.	GT:AD:DP:GQ:PL	1/1:0,3:3:9:85,9,0
chrM	2708	.	G	A	126.9	PASS	.	GT:AD:DP:GQ:PL	1/1:0,5:5:15:155,15,0
chrM	16364	.	T	C	241.84	PASS	.	GT:AD:DP:GQ:PL	1/1:0,6:6:18:270,18,0
chr1	3546264	rs137965653	CCGGG	C	277.77	PASS	.	GT:AD:DP:GQ:PL	1/1:0,7:7:21:315,21,0
chr1	59465926	rs2764901	A	C	337.77	PASS	.	GT:AD:DP:GQ:PL	0/1:22,11:33:99:366,0,1040
chr1	60280749	rs113730234	GT	G	360.74	PASS	.	GT:AD:DP:GQ:PL	1/1:0,10:10:30:398,30,0
chr1	62231924	rs141761262	T	TTGA	53.7	PASS	.	GT:AD:DP:GQ:PL	1/1:0,2:2:6:90,6,0
chr1	62627675	rs2481676	G	A	191.77	PASS	.	GT:AD:DP:GQ:PL	0/1:6,7:13:99:220,0,170
chr1	63113511	rs746735	C	A	202.77	PASS	.	GT:AD:DP:GQ:PL	0/1:4,7:11:99:231,0,133
chr1	64097432	rs1126728	C	T	273.77	PASS	.	GT:AD:DP:GQ:PL	0/1:13,10:23:99:302,0,360
chr1	64698411	rs2029868	T	C	45.77	PASS	.	GT:AD:DP:GQ:PL	0/1:1,2:3:29:74,0,29
chr1	67288045	rs482082	C	T	140.77	PASS	.	GT:AD:DP:GQ:PL	0/1:8,6:14:99:169,0,245
chr1	67562106	rs6670381	G	T	46.74	PASS	.	GT:AD:DP:GQ:PL	1/1:0,2:2:6:74,6,0
chr1	70397087	rs7530457	T	C	54.77	PASS	.	GT:AD:DP:GQ:PL	0/1:7,3:10:83:83,0,233
...(etc, 7191 lines in total)

I got an fatal Error when running the last procedure of STEP2 whose Error message is :

executor >  local (19)                                                                                              [60/1956]
[a3/308b14] process > msms_searching (spec-00037.mgf)                   [100%] 15 of 15 ✔
[ae/c73260] process > calculate_fdr (calculate_fdr)                     [100%] 1 of 1 ✔
[c4/516371] process > prepare_pepquery_input (prepare_pepquery_input)   [100%] 1 of 1 ✔
[68/fd6ea1] process > run_pepquery (run_pepquery)                       [100%] 1 of 1 ✔
[67/fd2463] process > add_pepquery_validation (add_pepquery_validation) [100%] 1 of 1, failed: 1 ✘
Error executing process > 'add_pepquery_validation (add_pepquery_validation)'

Caused by:
  Process `add_pepquery_validation (add_pepquery_validation)` terminated with an error exit status (1)

Command executed:

  #!/usr/bin/env /usr/local/bin/Rscript
     library(dplyr)
     library(readr)
     library(stringr)
  
     psms <- read_tsv("novel_peptides_psm.tsv")
  
     psm_rank_file = "pepquery/psm_rank.txt"
     if(file.exists(psm_rank_file)){
         psm_rank <- read_tsv(psm_rank_file)
  if("n_ptm" %in% names(psm_rank)){
             psm_rank <- psm_rank %>% filter(pvalue<=0.01,n_ptm==0,rank==1)
             psms$pepquery <- ifelse(psms$peptide %in% psm_rank$peptide,1,0)
  }else{
      psms$pepquery <- 0ter(),
  }
     }else{
         psms$pepquery <- 0
     }
     psms %>% write_tsv("novel_peptides_psm_pepquery.tsv")

Command exit status:
  1

Command output:
  (empty)

Command error:
  Bioconductor version 3.10 (BiocManager 1.30.10), ?BiocManager::install for help
  Bioconductor version '3.10' is out-of-date; the current release version '3.14'
    is available with R version '4.1'; see https://bioconductor.org/install
  
  Attaching package: ‘dplyr’
  
  The following objects are masked from ‘package:stats’:
 
      filter, lag
  
  The following objects are masked from ‘package:base’:
  
      intersect, setdiff, setequal, union
  
  Parsed with column specification:
  cols(
    index = col_character(),
    evalue = col_character(),
    ion_score = col_character(),
    charge = col_character(),
    mass = col_character(),
    mz = col_character(),
    delta_da = col_character(),
    delta_ppm = col_character(),
    peptide = col_character(),
    isdecoy = col_character(),
    miss = col_character(),
    protein = col_character(),
    position = col_character(),
    rt = col_character(),
    isSAP = col_character(),
    mods = col_character(),
    FDR = col_character(),
    Qvalue = col_character(),
    is_novel = col_character()
  )
  Error in `$<-.data.frame`(`*tmp*`, pepquery, value = 0) : 
    replacement has 1 row, data has 0
  Calls: $<- -> $<-.data.frame
  Execution halted

Work dir:
 /neoantigen2/work/67/fd2463881a197b5022a22c8c2c78a2

Tip: when you have fixed the problem you can continue the execution adding the option `-resume` to the run command line

I think it is caused by the empty of the intermediate file:
/neoantigen2/work/7d/3269b5449820da00611a534f20e697/novel_peptides_psm.tsv
and the novel_peptides_psm.tsv looks like:

index   evalue  ion_score       charge  mass    mz      delta_da        delta_ppm       peptide isdecoy miss    protein posit

I don't understand why the number of rows affect the pipeline's execution.

Could you help me out ?

Process `pre_processing (test_vcf_files.tsv)` terminated with an error exit status (255)

I am using neoflow and I am getting the following error with the example data that the pipeline comes with. What could be the problem? I am running this work on HPC
nextflow run neoflow_db.nf bin/ --ref_dir /scratch/oknjav001/transcriptomics/proteogenomics/annovar/annovar/humandb --vcf_file test_vcf_files.tsv --annovar_dir /scratch/oknjav001/transcriptomics/proteogenomics/annovar/annovar --ref_ver hg19 --out_dir .
N E X T F L O W ~ version 19.04.1
Launching neoflow_db.nf [condescending_bell] - revision: 96dbe17e38
Format input mapping file: /scratch/oknjav001/transcriptomics/proteogenomics/neoflow/test_vcf_files.tsv!
New mapping file: ./test_vcf_files.tsv!
[warm up] executor > local
WARN: Singularity cache directory has not been defined -- Remote image will be stored in the path: /scratch/oknjav001/transcriptomics/proteogenomics/neoflow/work/singularity
Pulling Singularity image docker://proteomics/pga:latest [cache /scratch/oknjav001/transcriptomics/proteogenomics/neoflow/work/singularity/proteomics-pga-latest.img]
executor > local (1)
[a6/9d551d] process > pre_processing [100%] 1 of 1, failed: 1 ✘
ERROR ~ Error executing process > 'pre_processing (test_vcf_files.tsv)'

Caused by:
Process pre_processing (test_vcf_files.tsv) terminated with an error exit status (255)

Command executed:

#!/usr/bin/env /usr/local/bin/Rscript

library(dplyr)
library(readr)

a = read.delim("/scratch/oknjav001/transcriptomics/proteogenomics/neoflow/test_vcf_files.tsv")
experiment_names = unique(a[,"experiment"])
for(f in experiment_names){
dat = a %>% filter(experiment == f)
out_file = paste(f,"-mapping_file.tsv",sep="")
write_tsv(dat,out_file)
}

Command exit status:
255

Command output:
(empty)

Command error:
FATAL: could not open image 1821:1821: failed to retrieve path for 1821:1821: lstat 1821:1821: no such file or directory

Work dir:
/scratch/oknjav001/transcriptomics/proteogenomics/neoflow/work/a6/9d551d5f30602f53e2d23a1da77c1d

Tip: when you have fixed the problem you can continue the execution appending to the nextflow command line the option -resume

-- Check '.nextflow.log' file for details

variant identification step with --pv_fixmod parameters

Hi, thank you for a great tool!
I trying out neoflow and managed to get the example file running with the help of the readme file.
However, while trying to optimize it with our data, I was unable to find descriptions of --pv_fixmod parameters other than the fact that the format is entered in numbers (1,2,3)

Where would I be able to find which modification corresponds to which number for this parameter?

Thank you in advance

No output was generated after module 4 finished

Hello,

I tested all four modules with the example data, however, only module 1 and 3 finished successfully.

I got the same error as issue #4 in module 2.

As for module 4, despite the log suggested a successful run...

Nothing was created in my output directory. No "neoantigen_prediction" subdirectory, no neoantigen prediction result, there was nothing.

Can anyone help? Thx!

bioconductor updated yet neoflow keeps showing update error

I have been trying the 2. Variant peptide identification step with my own data and I keep getting the error that bioconductor is not updated which I already have along with R.

When I check R, it runs in the version of R version 4.2.1 (2022-06-23) and Bioconductor is in the version of 3.15.
> library(BiocManager)
Bioconductor version 3.15 (BiocManager 1.30.18), R 4.2.1 (2022-06-23)

The error occurs in the last process and there were no issues during the example file run:
Below, I have attached the full error message once the command was executed:

[69/78f93c] process > msms_searching (PDAC_102076... [100%] 24 of 24, cached:...
[5c/bcddea] process > calculate_fdr (calculate_fdr) [100%] 1 of 1, cached: 1 ✔
[c8/3a5f19] process > prepare_pepquery_input (prep... [100%] 1 of 1, cached: 1 ✔
[55/8df182] process > run_pepquery (run_pepquery) [100%] 1 of 1, cached: 1 ✔
[55/4a2849] process > add_pepquery_validation (add... [100%] 1 of 1, failed: 1 ✘
Error executing process > 'add_pepquery_validation (add_pepquery_validation)'

Caused by:
Process add_pepquery_validation (add_pepquery_validation) terminated with an error exit status (1)

Command executed:

#!/usr/bin/env /usr/local/bin/Rscript
library(dplyr)
library(readr)
library(stringr)

 psms <- read_tsv("novel_peptides_psm.tsv")

 psm_rank_file = "pepquery/psm_rank.txt"
 if(file.exists(psm_rank_file)){
     psm_rank <- read_tsv(psm_rank_file)

if("n_ptm" %in% names(psm_rank)){
psm_rank <- psm_rank %>% filter(pvalue<=0.01,n_ptm==0,rank==1)
psms$pepquery <- ifelse(psms$peptide %in% psm_rank$peptide,1,0)
}else{
psms$pepquery <- 0
}
}else{
psms$pepquery <- 0
}
psms %>% write_tsv("novel_peptides_psm_pepquery.tsv")

Command exit status:
1

Command output:
(empty)

Command error:
Bioconductor version 3.10 (BiocManager 1.30.10), ?BiocManager::install for help
Bioconductor version '3.10' is out-of-date; the current release version '3.15'
is available with R version '4.2'; see https://bioconductor.org/install

Attaching package: ‘dplyr’

The following objects are masked from ‘package:stats’:

  filter, lag

The following objects are masked from ‘package:base’:

  intersect, setdiff, setequal, union

Parsed with column specification:
cols(
index = col_character(),
evalue = col_character(),
ion_score = col_character(),
charge = col_character(),
mass = col_character(),
mz = col_character(),
delta_da = col_character(),
delta_ppm = col_character(),
peptide = col_character(),
isdecoy = col_character(),
miss = col_character(),
protein = col_character(),
position = col_character(),
rt = col_character(),
isSAP = col_character(),
mods = col_character(),
FDR = col_character(),
Qvalue = col_character(),
is_novel = col_character()
)
Error in $<-.data.frame(*tmp*, pepquery, value = 0) :
replacement has 1 row, data has 0
Calls: $<- -> $<-.data.frame
Execution halted

Would there be anything I may be missing?

Thank you again in advance

Error with demo in STEP2: executing process > 'msms_searching (spec-00139.mgf)'

I succeeded in running the STEP1, but failed in STEP2, all information I know about error are as follows :

Error executing process > 'msms_searching (spec-00139.mgf)'

Caused by:
  Process `msms_searching (spec-00139.mgf)` terminated with an error exit status (2)

Command executed:

  #!/bin/sh
  /opt/comet.2018014.linux.exe -Pcomet_parameter.txt -Nspec-00139_rawResults -Dneoflow_crc_target_decoy.fasta spec-00139.mgf
  sed -i '1d' spec-00139_rawResults.txt
  sed -i '1 s/$/ "2018.0na/' spec-00139_rawResults.txt

Command exit status:
  2

Command output:
   Comet version "2018.01 rev. 4"

Command error:
   Comet version "2018.01 rev. 4"
  
  Segmentation fault (core dumped)
  sed: can't read spec-00139_rawResults.txt: No such file or directory
  sed: can't read spec-00139_rawResults.txt: No such file or directory

Work dir:
  /root/work/8c/e6ebc4108dbc902d529873b78827ae

Tip: you can try to figure out what's wrong by changing to the process work dir and showing the script file named `.command.sh`

I'm not sure if I need to install the MS/MS searching engines like comet (the example of STEP2 in demo).

Also, I supported the command lines I used in STEP2, which may give more details:

nextflow run /root/neoflow/neoflow_msms.nf --ms /root/work/example_data/mgf/ --msms_para_file /root/work/example_data/comet_parameter.txt --search_engine comet --db /root/output/customized_database/neoflow_crc_target_decoy.fasta --out_dir /root/output --pv_refdb /root/output/customized_database/ref.fasta --pv_tol 20 --pv_itol 0.05

I am a complete novice in this field and really hope to meet someone to give advice～
Thanks in advance!!!

error with demo in STEP2: calculate_fdr

Hi,
I got an error with calculateFDR in step2

Looking forward to your reply!
Thank you very much!

FATAL: could not open image 10158:10011: failed to retrieve path for 10158:10011: lstat

N E X T F L O W ~ version 19.10.0
Launching neoflow_db.nf [kickass_mcnulty] - revision: 96dbe17e38
Format input mapping file: /cbio/users/javanokendo/proteogenomics/example_data/test_vcf_files.tsv!
New mapping file: ./test_vcf_files.tsv!
executor > local (1)
[6e/622d9c] process > pre_processing (test_vcf_files.tsv) [100%] 1 of 1, failed: 1 ✘
[- ] process > variant_annotation -
[- ] process > database_construction -
[- ] process > format_db -
[- ] process > generate_decoy_db -
Error executing process > 'pre_processing (test_vcf_files.tsv)'

Caused by:
Process pre_processing (test_vcf_files.tsv) terminated with an error exit status (255)

Command executed:

#!/usr/bin/env /usr/local/bin/Rscript

library(dplyr)
library(readr)

a = read.delim("/cbio/users/javanokendo/proteogenomics/neoflow/test_vcf_files.tsv")
experiment_names = unique(a[,"experiment"])
for(f in experiment_names){
dat = a %>% filter(experiment == f)
out_file = paste(f,"-mapping_file.tsv",sep="")
write_tsv(dat,out_file)
}

Command exit status:
255

Command output:
(empty)

Command error:
FATAL: could not open image 10158:10011: failed to retrieve path for 10158:10011: lstat 10158:10011: no such file or directory
Work dir:
/cbio/users/javanokendo/proteogenomics/neoflow/work/6e/622d9c1d14877e59caa996bfe306b2

Tip: when you have fixed the problem you can continue the execution adding the option -resume to the run command line

neoflow_db.nf doesn't allow not outputting reference protein sequences

noeflow_db.nf doesn't allow the -t flag of customProDBJ which allows not having reference protein sequences being output. I did a quick fix here and am happy to open a PR.

Btw, sorry that my text editor seems to trim off trailing spaces automatically so the the change looks more than it is.

https://github.com/zhuchcn/neoflow/compare/1c4f641..178fed6#diff-237f2dce2ee13cbc946bdefac8e3efe2b4bb93257576c8c0dc46f7098d5545c6

Recommend Projects

React

A declarative, efficient, and flexible JavaScript library for building user interfaces.
Vue.js

🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
Typescript

TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
TensorFlow

An Open Source Machine Learning Framework for Everyone
Django

The Web framework for perfectionists with deadlines.
Laravel

A PHP framework for web artisans
D3

Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

javascript

JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
web

Some thing interesting about web. New door for the world.
server

A server is a program made to process requests and deliver data to clients.
Machine learning

Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Visualization

Some thing interesting about visualization, use data art
Game

Some thing interesting about game, make everyone happy.

Recommend Org

Facebook

We are working to build community through open source technology. NB: members must have two-factor auth.
Microsoft

Open source projects and samples from Microsoft.
Google

Google ❤️ Open Source for everyone.
Alibaba

Alibaba Open Source for everyone
D3

Data-Driven Documents codes.
Tencent

China tencent open source team.