bzhanglab / neoflow Goto Github PK
View Code? Open in Web Editor NEWNeoFlow: a proteogenomics pipeline for neoantigen discovery
NeoFlow: a proteogenomics pipeline for neoantigen discovery
I tried to use neoflow by exampledata.But I get an error when I run neoflow_msms.nf
this is my code
./nextflow run ./neoflow-master/neoflow_msms.nf \ --ms /mnt/g/example_data/mgf \ --msms_para_file /mnt/g/example_data/comet_parameter.txt \ --search_engine comet --db ./test/customized_database/neoflow_crc_target_decoy.fasta --out_dir test2 \ --pv_refdb ./test/customized_database/ref.fasta --pv_tol 20 --pv_itol 0.05
then I get the following erros:
N E X T F L O W ~ version 21.10.6 Launching
./neoflow-master/neoflow_msms.nf[reverent_watson] - revision: 9f41504eb3 Process multiple MS/MS files. [- ] process > msms_searching - [- ] process > calculate_fdr - [- ] process > prepare_pepquery_input - [- ] process > run_pepquery - [- ] process > add_pepquery_validation - WARN: Access to undefined parameter
cpu-- Initialise it to a default value eg.
params.cpu = some_value`
Error executing process > 'msms_searching (spec-00565.mgf)'
Caused by:
For input string: "null"
Exception in thread "Task submitter" java.lang.NumberFormatException: For input string: "null"
at java.lang.NumberFormatException.forInputString(NumberFormatException.java:65)
at java.lang.Integer.parseInt(Integer.java:580)
at java.lang.Integer.valueOf(Integer.java:766)
at org.codehaus.groovy.runtime.StringGroovyMethods.toInteger(StringGroovyMethods.java:3134)
at org.codehaus.groovy.runtime.StringGroovyMethods.asType(StringGroovyMethods.java:192)
at nextflow.extension.Bolts.asType(Bolts.groovy:449)
at sun.reflect.GeneratedMethodAccessor12.invoke(Unknown Source)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:498)
at org.codehaus.groovy.runtime.metaclass.ReflectionMetaMethod.invoke(ReflectionMetaMethod.java:54)
at org.codehaus.groovy.runtime.metaclass.NewInstanceMetaMethod.invoke(NewInstanceMetaMethod.java:54)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:323)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1268)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1035)
at org.codehaus.groovy.runtime.InvokerHelper.invokePojoMethod(InvokerHelper.java:1017)
at org.codehaus.groovy.runtime.InvokerHelper.invokeMethod(InvokerHelper.java:1008)
at org.codehaus.groovy.runtime.ScriptBytecodeAdapter.invokeMethodN(ScriptBytecodeAdapter.java:180)
at org.codehaus.groovy.runtime.ScriptBytecodeAdapter.asType(ScriptBytecodeAdapter.java:603)
at nextflow.processor.TaskConfig.getCpus(TaskConfig.groovy:282)
at nextflow.processor.TaskConfig$getCpus$18.call(Unknown Source)
at nextflow.processor.TaskHandler.getTraceRecord(TaskHandler.groovy:168)
at nextflow.executor.LocalTaskHandler.super$2$getTraceRecord(LocalExecutor.groovy)
at sun.reflect.GeneratedMethodAccessor336.invoke(Unknown Source)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:498)
at org.codehaus.groovy.reflection.CachedMethod.invoke(CachedMethod.java:107)
at groovy.lang.MetaMethod.doMethodInvoke(MetaMethod.java:323)
at groovy.lang.MetaClassImpl.invokeMethod(MetaClassImpl.java:1268)
at org.codehaus.groovy.runtime.ScriptBytecodeAdapter.invokeMethodOnSuperN(ScriptBytecodeAdapter.java:144)
at org.codehaus.groovy.runtime.ScriptBytecodeAdapter.invokeMethodOnSuper0(ScriptBytecodeAdapter.java:164)
at nextflow.executor.LocalTaskHandler.getTraceRecord(LocalExecutor.groovy:256)
at nextflow.Session.notifyTaskComplete(Session.groovy:972)
at nextflow.processor.TaskPollingMonitor.submitPendingTasks(TaskPollingMonitor.groovy:566)
at nextflow.processor.TaskPollingMonitor.submitLoop(TaskPollingMonitor.groovy:387)
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
[- ] process > msms_searching -
[- ] process > calculate_fdr -
[- ] process > prepare_pepquery_input -
[- ] process > run_pepquery -
[- ] process > add_pepquery_validation -
WARN: Access to undefined parameter cpu
-- Initialise it to a default value eg. params.cpu = some_value
Error executing process > 'msms_searching (spec-00565.mgf)'
Caused by:
For input string: "null"
`
Is there some one can help me? thank you very much!
I copied test data from example_data folder provided by the neoflow.
the input_vcf_list.txt file looks like:
experiment sample file file_type
crc_test sample1 /neoantigen2/input/sample1.vcf somatic
the copied sample1.vcf looks like:
##fileformat=VCFv4.2
##contig=<ID=chrM,length=16571,assembly=hg19>
##contig=<ID=chr1,length=249250621,assembly=hg19>
##contig=<ID=chr2,length=243199373,assembly=hg19>
##contig=<ID=chr3,length=198022430,assembly=hg19>
##contig=<ID=chr4,length=191154276,assembly=hg19>
##contig=<ID=chr5,length=180915260,assembly=hg19>
##contig=<ID=chr6,length=171115067,assembly=hg19>
##contig=<ID=chr7,length=159138663,assembly=hg19>
##contig=<ID=chr8,length=146364022,assembly=hg19>
##contig=<ID=chr9,length=141213431,assembly=hg19>
##contig=<ID=chr10,length=135534747,assembly=hg19>
##contig=<ID=chr11,length=135006516,assembly=hg19>
##contig=<ID=chr12,length=133851895,assembly=hg19>
##contig=<ID=chr13,length=115169878,assembly=hg19>
##contig=<ID=chr14,length=107349540,assembly=hg19>
##contig=<ID=chr15,length=102531392,assembly=hg19>
##contig=<ID=chr16,length=90354753,assembly=hg19>
##contig=<ID=chr17,length=81195210,assembly=hg19>
##contig=<ID=chr18,length=78077248,assembly=hg19>
##contig=<ID=chr19,length=59128983,assembly=hg19>
##contig=<ID=chr20,length=63025520,assembly=hg19>
##contig=<ID=chr21,length=48129895,assembly=hg19>
##contig=<ID=chr22,length=51304566,assembly=hg19>
##contig=<ID=chrX,length=155270560,assembly=hg19>
##contig=<ID=chrY,length=59373566,assembly=hg19>
##contig=<ID=chr1_gl000191_random,length=106433,assembly=hg19>
##contig=<ID=chr1_gl000192_random,length=547496,assembly=hg19>
##contig=<ID=chr4_gl000193_random,length=189789,assembly=hg19>
##contig=<ID=chr4_gl000194_random,length=191469,assembly=hg19>
##contig=<ID=chr6_cox_hap2,length=4795371,assembly=hg19>
##contig=<ID=chr7_gl000195_random,length=182896,assembly=hg19>
##contig=<ID=chr9_gl000198_random,length=90085,assembly=hg19>
##contig=<ID=chr9_gl000199_random,length=169874,assembly=hg19>
##contig=<ID=chr17_gl000205_random,length=174588,assembly=hg19>
##contig=<ID=chr19_gl000208_random,length=92689,assembly=hg19>
##contig=<ID=chr19_gl000209_random,length=159169,assembly=hg19>
##contig=<ID=chrUn_gl000211,length=166566,assembly=hg19>
##contig=<ID=chrUn_gl000212,length=186858,assembly=hg19>
##contig=<ID=chrUn_gl000213,length=164239,assembly=hg19>
##contig=<ID=chrUn_gl000214,length=137718,assembly=hg19>
##contig=<ID=chrUn_gl000215,length=172545,assembly=hg19>
##contig=<ID=chrUn_gl000216,length=172294,assembly=hg19>
##contig=<ID=chrUn_gl000217,length=172149,assembly=hg19>
##contig=<ID=chrUn_gl000218,length=161147,assembly=hg19>
##contig=<ID=chrUn_gl000219,length=179198,assembly=hg19>
##contig=<ID=chrUn_gl000220,length=161802,assembly=hg19>
##contig=<ID=chrUn_gl000221,length=155397,assembly=hg19>
##contig=<ID=chrUn_gl000222,length=186861,assembly=hg19>
##contig=<ID=chrUn_gl000224,length=179693,assembly=hg19>
##contig=<ID=chrUn_gl000225,length=211173,assembly=hg19>
##contig=<ID=chrUn_gl000226,length=15008,assembly=hg19>
##contig=<ID=chrUn_gl000228,length=129120,assembly=hg19>
##contig=<ID=chrUn_gl000229,length=19913,assembly=hg19>
##contig=<ID=chrUn_gl000230,length=43691,assembly=hg19>
##contig=<ID=chrUn_gl000231,length=27386,assembly=hg19>
##contig=<ID=chrUn_gl000232,length=40652,assembly=hg19>
##contig=<ID=chrUn_gl000234,length=40531,assembly=hg19>
##contig=<ID=chrUn_gl000236,length=41934,assembly=hg19>
##contig=<ID=chrUn_gl000237,length=45867,assembly=hg19>
##contig=<ID=chrUn_gl000238,length=39939,assembly=hg19>
##contig=<ID=chrUn_gl000239,length=33824,assembly=hg19>
##contig=<ID=chrUn_gl000240,length=41933,assembly=hg19>
##contig=<ID=chrUn_gl000241,length=42152,assembly=hg19>
##contig=<ID=chrUn_gl000243,length=43341,assembly=hg19>
##reference=file:///data/kail/tmp/nxf.ovMAqCSHCz/ucsc.hg19.fasta
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT crc_cell_lines
chrM 73 . G A 207.78 PASS . GT:AD:DP:GQ:PL 1/1:0,9:9:27:236,27,0
chrM 150 . T C 85.28 PASS . GT:AD:DP:GQ:PL 1/1:0,3:3:9:113,9,0
chrM 410 . A T 169.84 PASS . GT:AD:DP:GQ:PL 1/1:0,6:6:18:198,18,0
chrM 515 . GCA G 83.25 PASS . GT:AD:DP:GQ:PL 1/1:0,3:3:9:120,9,0
chrM 2354 . C T 57.28 PASS . GT:AD:DP:GQ:PL 1/1:0,3:3:9:85,9,0
chrM 2708 . G A 126.9 PASS . GT:AD:DP:GQ:PL 1/1:0,5:5:15:155,15,0
chrM 16364 . T C 241.84 PASS . GT:AD:DP:GQ:PL 1/1:0,6:6:18:270,18,0
chr1 13868 . A G 72.77 PASS . GT:AD:DP:GQ:PL 0/1:16,6:22:99:101,0,367
chr1 13896 rs201696125 C A 50.77 PASS . GT:AD:DP:GQ:PL 0/1:14,5:19:79:79,0,340
chr1 14907 rs79585140 A G 919.77 PASS . GT:AD:DP:GQ:PL 0/1:20,38:58:99:948,0,429
chr1 14930 rs75454623 A G 878.77 PASS . GT:AD:DP:GQ:PL 0/1:16,34:50:99:907,0,341
chr1 15274 rs201931625 A T 62.28 PASS . GT:AD:DP:GQ:PL 1/1:0,3:3:9:90,9,0
chr1 16495 rs141130360 G C 41.77 PASS . GT:AD:DP:GQ:PL 0/1:14,5:19:70:70,0,395
chr1 16534 rs201459529 C T 298.77 PASS . GT:AD:DP:GQ:PL 0/1:5,15:20:67:327,0,67
chr1 16571 rs199676946 G A 188.77 PASS . GT:AD:DP:GQ:PL 0/1:4,10:14:61:217,0,61
chr1 1453304 rs141065088 C T 40.74 PASS . GT:AD:DP:GQ:PL 1/1:0,2:2:6:68,6,0
chr1 1454519 rs370448805 G C 51.77 PASS . GT:AD:DP:GQ:PL 0/1:2,3:5:63:80,0,63
chr1 3427514 rs146093263 GCACACGCCCCCACC G 98.25 PASS . GT:AD:DP:GQ:PL 1/1:0,3:3:9:135,9,0
chr1 3428160 rs2820999 T G 215.8 PASS . GT:AD:DP:GQ:PL 1/1:0,7:7:21:244,21,0
chr1 3496479 rs2794340 T C 33.77 PASS . GT:AD:DP:GQ:PL 0/1:2,2:4:62:62,0,64
chr1 3545175 rs147637374 GTTCTGGGAGCTCCTCCCCC G 151.82 PASS . GT:AD:DP:GQ:PL 1/1:0,4:4:17:189,17,0
chr1 3546264 rs137965653 CCGGG C 277.77 PASS . GT:AD:DP:GQ:PL 1/1:0,7:7:21:315,21,0
chr1 59147926 rs12139511 T C 769.77 PASS . GT:AD:DP:GQ:PL 1/1:0,22:22:66:798,66,0
chr1 59148118 rs17118103 A T 280.77 PASS . GT:AD:DP:GQ:PL 0/1:8,10:18:99:309,0,173
chr1 59150941 rs2206764 G A 396.77 PASS . GT:AD:DP:GQ:PL 1/1:0,13:13:39:425,39,0
chr1 59150997 rs5774421 TA T 88.87 PASS . GT:AD:DP:GQ:PL 1/1:0,5:5:15:126,15,0
chr1 59156155 rs12076049 C T 200.84 PASS . GT:AD:DP:GQ:PL 1/1:0,6:6:18:229,18,0
chr1 59158632 rs12097333 T C 584.77 PASS . GT:AD:DP:GQ:PL 1/1:0,18:18:54:613,54,0
chr1 59160724 rs66629118 TA T 63.0 PASS . GT:AD:DP:GQ:PL 1/1:0,4:4:12:100,12,0
chr1 59248813 rs2760499 G C 292.77 PASS . GT:AD:DP:GQ:PL 1/1:0,11:11:33:321,33,0
...(etc, 81914 lines in total)
I can run through STEP2 using these 2 files.
(base) [root@gpu01 neoantigen2]# sh test_cmd.sh
N E X T F L O W ~ version 21.04.3
Launching `./neoflow_db.nf` [compassionate_jennings] - revision: 421847b8f4
Format input mapping file: /neoantigen2/input/test_vcf_files.tsv!
New mapping file: output/test_vcf_files.tsv!
executor > local (5)
[7c/318276] process > pre_processing (test_vcf_files.tsv) [100%] 1 of 1 ✔
[87/d3b425] process > variant_annotation (crc_test-mapping_file.tsv) [100%] 1 of 1 ✔
[62/9f2138] process > database_construction (crc_test) [100%] 1 of 1 ✔
[dd/0d806c] process > format_db (crc_test) [100%] 1 of 1 ✔
[05/178767] process > generate_decoy_db (crc_test) [100%] 1 of 1 ✔
Completed at: 19-Jan-2022 05:12:16
Duration : 12m 59s
CPU hours : 0.2
Succeeded : 5
crc_test
N E X T F L O W ~ version 21.04.3
Launching `./neoflow_msms.nf` [dreamy_borg] - revision: 5cf4143baf
Process multiple MS/MS files.
executor > local (19)
[2b/f3de6e] process > msms_searching (spec-00037.mgf) [100%] 15 of 15 ✔
[d6/3db5c3] process > calculate_fdr (calculate_fdr) [100%] 1 of 1 ✔
[ab/67eada] process > prepare_pepquery_input (prepare_pepquery_input) [100%] 1 of 1 ✔
[47/b207b0] process > run_pepquery (run_pepquery) [100%] 1 of 1 ✔
[3c/c1bbee] process > add_pepquery_validation (add_pepquery_validation) [100%] 1 of 1 ✔
Completed at: 19-Jan-2022 06:14:34
Duration : 1h 2m 11s
CPU hours : 11.0
Succeeded : 19
but when I randomly sample 7191 vcf records from sample1.vcf before running the same pipeline,
it is exactly the same as the last one except for the number of rows.
this time the input vcf file looks like:
##fileformat=VCFv4.2
##contig=<ID=chrM,length=16571,assembly=hg19>
##contig=<ID=chr1,length=249250621,assembly=hg19>
##contig=<ID=chr2,length=243199373,assembly=hg19>
##contig=<ID=chr3,length=198022430,assembly=hg19>
##contig=<ID=chr4,length=191154276,assembly=hg19>
##contig=<ID=chr5,length=180915260,assembly=hg19>
##contig=<ID=chr6,length=171115067,assembly=hg19>
##contig=<ID=chr7,length=159138663,assembly=hg19>
##contig=<ID=chr8,length=146364022,assembly=hg19>
##contig=<ID=chr9,length=141213431,assembly=hg19>
##contig=<ID=chr10,length=135534747,assembly=hg19>
##contig=<ID=chr11,length=135006516,assembly=hg19>
##contig=<ID=chr12,length=133851895,assembly=hg19>
##contig=<ID=chr13,length=115169878,assembly=hg19>
##contig=<ID=chr14,length=107349540,assembly=hg19>
##contig=<ID=chr15,length=102531392,assembly=hg19>
##contig=<ID=chr16,length=90354753,assembly=hg19>
##contig=<ID=chr17,length=81195210,assembly=hg19>
##contig=<ID=chr18,length=78077248,assembly=hg19>
##contig=<ID=chr19,length=59128983,assembly=hg19>
##contig=<ID=chr20,length=63025520,assembly=hg19>
##contig=<ID=chr21,length=48129895,assembly=hg19>
##contig=<ID=chr22,length=51304566,assembly=hg19>
##contig=<ID=chrX,length=155270560,assembly=hg19>
##contig=<ID=chrY,length=59373566,assembly=hg19>
##contig=<ID=chr1_gl000191_random,length=106433,assembly=hg19>
##contig=<ID=chr1_gl000192_random,length=547496,assembly=hg19>
##contig=<ID=chr4_gl000193_random,length=189789,assembly=hg19>
##contig=<ID=chr4_gl000194_random,length=191469,assembly=hg19>
##contig=<ID=chr6_cox_hap2,length=4795371,assembly=hg19>
##contig=<ID=chr7_gl000195_random,length=182896,assembly=hg19>
##contig=<ID=chr9_gl000198_random,length=90085,assembly=hg19>
##contig=<ID=chr9_gl000199_random,length=169874,assembly=hg19>
##contig=<ID=chr17_gl000205_random,length=174588,assembly=hg19>
##contig=<ID=chr19_gl000208_random,length=92689,assembly=hg19>
##contig=<ID=chr19_gl000209_random,length=159169,assembly=hg19>
##contig=<ID=chrUn_gl000211,length=166566,assembly=hg19>
##contig=<ID=chrUn_gl000212,length=186858,assembly=hg19>
##contig=<ID=chrUn_gl000213,length=164239,assembly=hg19>
##contig=<ID=chrUn_gl000214,length=137718,assembly=hg19>
##contig=<ID=chrUn_gl000215,length=172545,assembly=hg19>
##contig=<ID=chrUn_gl000216,length=172294,assembly=hg19>
##contig=<ID=chrUn_gl000217,length=172149,assembly=hg19>
##contig=<ID=chrUn_gl000218,length=161147,assembly=hg19>
##contig=<ID=chrUn_gl000219,length=179198,assembly=hg19>
##contig=<ID=chrUn_gl000220,length=161802,assembly=hg19>
##contig=<ID=chrUn_gl000221,length=155397,assembly=hg19>
##contig=<ID=chrUn_gl000222,length=186861,assembly=hg19>
##contig=<ID=chrUn_gl000224,length=179693,assembly=hg19>
##contig=<ID=chrUn_gl000225,length=211173,assembly=hg19>
##contig=<ID=chrUn_gl000226,length=15008,assembly=hg19>
##contig=<ID=chrUn_gl000228,length=129120,assembly=hg19>
##contig=<ID=chrUn_gl000229,length=19913,assembly=hg19>
##contig=<ID=chrUn_gl000230,length=43691,assembly=hg19>
##contig=<ID=chrUn_gl000231,length=27386,assembly=hg19>
##contig=<ID=chrUn_gl000232,length=40652,assembly=hg19>
##contig=<ID=chrUn_gl000234,length=40531,assembly=hg19>
##contig=<ID=chrUn_gl000236,length=41934,assembly=hg19>
##contig=<ID=chrUn_gl000237,length=45867,assembly=hg19>
##contig=<ID=chrUn_gl000238,length=39939,assembly=hg19>
##contig=<ID=chrUn_gl000239,length=33824,assembly=hg19>
##contig=<ID=chrUn_gl000240,length=41933,assembly=hg19>
##contig=<ID=chrUn_gl000241,length=42152,assembly=hg19>
##contig=<ID=chrUn_gl000243,length=43341,assembly=hg19>
##reference=file:///data/kail/tmp/nxf.ovMAqCSHCz/ucsc.hg19.fasta
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT crc_cell_lines
chrM 73 . G A 207.78 PASS . GT:AD:DP:GQ:PL 1/1:0,9:9:27:236,27,0
chrM 150 . T C 85.28 PASS . GT:AD:DP:GQ:PL 1/1:0,3:3:9:113,9,0
chrM 410 . A T 169.84 PASS . GT:AD:DP:GQ:PL 1/1:0,6:6:18:198,18,0
chrM 515 . GCA G 83.25 PASS . GT:AD:DP:GQ:PL 1/1:0,3:3:9:120,9,0
chrM 2354 . C T 57.28 PASS . GT:AD:DP:GQ:PL 1/1:0,3:3:9:85,9,0
chrM 2708 . G A 126.9 PASS . GT:AD:DP:GQ:PL 1/1:0,5:5:15:155,15,0
chrM 16364 . T C 241.84 PASS . GT:AD:DP:GQ:PL 1/1:0,6:6:18:270,18,0
chr1 3546264 rs137965653 CCGGG C 277.77 PASS . GT:AD:DP:GQ:PL 1/1:0,7:7:21:315,21,0
chr1 59465926 rs2764901 A C 337.77 PASS . GT:AD:DP:GQ:PL 0/1:22,11:33:99:366,0,1040
chr1 60280749 rs113730234 GT G 360.74 PASS . GT:AD:DP:GQ:PL 1/1:0,10:10:30:398,30,0
chr1 62231924 rs141761262 T TTGA 53.7 PASS . GT:AD:DP:GQ:PL 1/1:0,2:2:6:90,6,0
chr1 62627675 rs2481676 G A 191.77 PASS . GT:AD:DP:GQ:PL 0/1:6,7:13:99:220,0,170
chr1 63113511 rs746735 C A 202.77 PASS . GT:AD:DP:GQ:PL 0/1:4,7:11:99:231,0,133
chr1 64097432 rs1126728 C T 273.77 PASS . GT:AD:DP:GQ:PL 0/1:13,10:23:99:302,0,360
chr1 64698411 rs2029868 T C 45.77 PASS . GT:AD:DP:GQ:PL 0/1:1,2:3:29:74,0,29
chr1 67288045 rs482082 C T 140.77 PASS . GT:AD:DP:GQ:PL 0/1:8,6:14:99:169,0,245
chr1 67562106 rs6670381 G T 46.74 PASS . GT:AD:DP:GQ:PL 1/1:0,2:2:6:74,6,0
chr1 70397087 rs7530457 T C 54.77 PASS . GT:AD:DP:GQ:PL 0/1:7,3:10:83:83,0,233
...(etc, 7191 lines in total)
I got an fatal Error when running the last procedure of STEP2 whose Error message is :
executor > local (19) [60/1956]
[a3/308b14] process > msms_searching (spec-00037.mgf) [100%] 15 of 15 ✔
[ae/c73260] process > calculate_fdr (calculate_fdr) [100%] 1 of 1 ✔
[c4/516371] process > prepare_pepquery_input (prepare_pepquery_input) [100%] 1 of 1 ✔
[68/fd6ea1] process > run_pepquery (run_pepquery) [100%] 1 of 1 ✔
[67/fd2463] process > add_pepquery_validation (add_pepquery_validation) [100%] 1 of 1, failed: 1 ✘
Error executing process > 'add_pepquery_validation (add_pepquery_validation)'
Caused by:
Process `add_pepquery_validation (add_pepquery_validation)` terminated with an error exit status (1)
Command executed:
#!/usr/bin/env /usr/local/bin/Rscript
library(dplyr)
library(readr)
library(stringr)
psms <- read_tsv("novel_peptides_psm.tsv")
psm_rank_file = "pepquery/psm_rank.txt"
if(file.exists(psm_rank_file)){
psm_rank <- read_tsv(psm_rank_file)
if("n_ptm" %in% names(psm_rank)){
psm_rank <- psm_rank %>% filter(pvalue<=0.01,n_ptm==0,rank==1)
psms$pepquery <- ifelse(psms$peptide %in% psm_rank$peptide,1,0)
}else{
psms$pepquery <- 0ter(),
}
}else{
psms$pepquery <- 0
}
psms %>% write_tsv("novel_peptides_psm_pepquery.tsv")
Command exit status:
1
Command output:
(empty)
Command error:
Bioconductor version 3.10 (BiocManager 1.30.10), ?BiocManager::install for help
Bioconductor version '3.10' is out-of-date; the current release version '3.14'
is available with R version '4.1'; see https://bioconductor.org/install
Attaching package: ‘dplyr’
The following objects are masked from ‘package:stats’:
filter, lag
The following objects are masked from ‘package:base’:
intersect, setdiff, setequal, union
Parsed with column specification:
cols(
index = col_character(),
evalue = col_character(),
ion_score = col_character(),
charge = col_character(),
mass = col_character(),
mz = col_character(),
delta_da = col_character(),
delta_ppm = col_character(),
peptide = col_character(),
isdecoy = col_character(),
miss = col_character(),
protein = col_character(),
position = col_character(),
rt = col_character(),
isSAP = col_character(),
mods = col_character(),
FDR = col_character(),
Qvalue = col_character(),
is_novel = col_character()
)
Error in `$<-.data.frame`(`*tmp*`, pepquery, value = 0) :
replacement has 1 row, data has 0
Calls: $<- -> $<-.data.frame
Execution halted
Work dir:
/neoantigen2/work/67/fd2463881a197b5022a22c8c2c78a2
Tip: when you have fixed the problem you can continue the execution adding the option `-resume` to the run command line
I think it is caused by the empty of the intermediate file:
/neoantigen2/work/7d/3269b5449820da00611a534f20e697/novel_peptides_psm.tsv
and the novel_peptides_psm.tsv looks like:
index evalue ion_score charge mass mz delta_da delta_ppm peptide isdecoy miss protein posit
I don't understand why the number of rows affect the pipeline's execution.
Could you help me out ?
I am using neoflow and I am getting the following error with the example data that the pipeline comes with. What could be the problem? I am running this work on HPC
nextflow run neoflow_db.nf bin/ --ref_dir /scratch/oknjav001/transcriptomics/proteogenomics/annovar/annovar/humandb --vcf_file test_vcf_files.tsv --annovar_dir /scratch/oknjav001/transcriptomics/proteogenomics/annovar/annovar --ref_ver hg19 --out_dir .
N E X T F L O W ~ version 19.04.1
Launching neoflow_db.nf
[condescending_bell] - revision: 96dbe17e38
Format input mapping file: /scratch/oknjav001/transcriptomics/proteogenomics/neoflow/test_vcf_files.tsv!
New mapping file: ./test_vcf_files.tsv!
[warm up] executor > local
WARN: Singularity cache directory has not been defined -- Remote image will be stored in the path: /scratch/oknjav001/transcriptomics/proteogenomics/neoflow/work/singularity
Pulling Singularity image docker://proteomics/pga:latest [cache /scratch/oknjav001/transcriptomics/proteogenomics/neoflow/work/singularity/proteomics-pga-latest.img]
executor > local (1)
[a6/9d551d] process > pre_processing [100%] 1 of 1, failed: 1 ✘
ERROR ~ Error executing process > 'pre_processing (test_vcf_files.tsv)'
Caused by:
Process pre_processing (test_vcf_files.tsv)
terminated with an error exit status (255)
Command executed:
#!/usr/bin/env /usr/local/bin/Rscript
library(dplyr)
library(readr)
a = read.delim("/scratch/oknjav001/transcriptomics/proteogenomics/neoflow/test_vcf_files.tsv")
experiment_names = unique(a[,"experiment"])
for(f in experiment_names){
dat = a %>% filter(experiment == f)
out_file = paste(f,"-mapping_file.tsv",sep="")
write_tsv(dat,out_file)
}
Command exit status:
255
Command output:
(empty)
Command error:
FATAL: could not open image 1821:1821: failed to retrieve path for 1821:1821: lstat 1821:1821: no such file or directory
Work dir:
/scratch/oknjav001/transcriptomics/proteogenomics/neoflow/work/a6/9d551d5f30602f53e2d23a1da77c1d
Tip: when you have fixed the problem you can continue the execution appending to the nextflow command line the option -resume
-- Check '.nextflow.log' file for details
Hi, thank you for a great tool!
I trying out neoflow and managed to get the example file running with the help of the readme file.
However, while trying to optimize it with our data, I was unable to find descriptions of --pv_fixmod parameters other than the fact that the format is entered in numbers (1,2,3)
Where would I be able to find which modification corresponds to which number for this parameter?
Thank you in advance
Hello,
I tested all four modules with the example data, however, only module 1 and 3 finished successfully.
I got the same error as issue #4 in module 2.
As for module 4, despite the log suggested a successful run...
Nothing was created in my output directory. No "neoantigen_prediction" subdirectory, no neoantigen prediction result, there was nothing.
Can anyone help? Thx!
I have been trying the 2. Variant peptide identification step with my own data and I keep getting the error that bioconductor is not updated which I already have along with R.
When I check R, it runs in the version of R version 4.2.1 (2022-06-23) and Bioconductor is in the version of 3.15.
> library(BiocManager)
Bioconductor version 3.15 (BiocManager 1.30.18), R 4.2.1 (2022-06-23)
The error occurs in the last process and there were no issues during the example file run:
Below, I have attached the full error message once the command was executed:
[69/78f93c] process > msms_searching (PDAC_102076... [100%] 24 of 24, cached:...
[5c/bcddea] process > calculate_fdr (calculate_fdr) [100%] 1 of 1, cached: 1 ✔
[c8/3a5f19] process > prepare_pepquery_input (prep... [100%] 1 of 1, cached: 1 ✔
[55/8df182] process > run_pepquery (run_pepquery) [100%] 1 of 1, cached: 1 ✔
[55/4a2849] process > add_pepquery_validation (add... [100%] 1 of 1, failed: 1 ✘
Error executing process > 'add_pepquery_validation (add_pepquery_validation)'
Caused by:
Process add_pepquery_validation (add_pepquery_validation)
terminated with an error exit status (1)
Command executed:
#!/usr/bin/env /usr/local/bin/Rscript
library(dplyr)
library(readr)
library(stringr)
psms <- read_tsv("novel_peptides_psm.tsv")
psm_rank_file = "pepquery/psm_rank.txt"
if(file.exists(psm_rank_file)){
psm_rank <- read_tsv(psm_rank_file)
if("n_ptm" %in% names(psm_rank)){
psm_rank <- psm_rank %>% filter(pvalue<=0.01,n_ptm==0,rank==1)
psms$pepquery <- ifelse(psms$peptide %in% psm_rank$peptide,1,0)
}else{
psms$pepquery <- 0
}
}else{
psms$pepquery <- 0
}
psms %>% write_tsv("novel_peptides_psm_pepquery.tsv")
Command exit status:
1
Command output:
(empty)
Command error:
Bioconductor version 3.10 (BiocManager 1.30.10), ?BiocManager::install for help
Bioconductor version '3.10' is out-of-date; the current release version '3.15'
is available with R version '4.2'; see https://bioconductor.org/install
Attaching package: ‘dplyr’
The following objects are masked from ‘package:stats’:
filter, lag
The following objects are masked from ‘package:base’:
intersect, setdiff, setequal, union
Parsed with column specification:
cols(
index = col_character(),
evalue = col_character(),
ion_score = col_character(),
charge = col_character(),
mass = col_character(),
mz = col_character(),
delta_da = col_character(),
delta_ppm = col_character(),
peptide = col_character(),
isdecoy = col_character(),
miss = col_character(),
protein = col_character(),
position = col_character(),
rt = col_character(),
isSAP = col_character(),
mods = col_character(),
FDR = col_character(),
Qvalue = col_character(),
is_novel = col_character()
)
Error in $<-.data.frame
(*tmp*
, pepquery, value = 0) :
replacement has 1 row, data has 0
Calls:
Execution halted
Would there be anything I may be missing?
Thank you again in advance
I succeeded in running the STEP1, but failed in STEP2, all information I know about error are as follows :
Error executing process > 'msms_searching (spec-00139.mgf)'
Caused by:
Process `msms_searching (spec-00139.mgf)` terminated with an error exit status (2)
Command executed:
#!/bin/sh
/opt/comet.2018014.linux.exe -Pcomet_parameter.txt -Nspec-00139_rawResults -Dneoflow_crc_target_decoy.fasta spec-00139.mgf
sed -i '1d' spec-00139_rawResults.txt
sed -i '1 s/$/ "2018.0na/' spec-00139_rawResults.txt
Command exit status:
2
Command output:
Comet version "2018.01 rev. 4"
Command error:
Comet version "2018.01 rev. 4"
Segmentation fault (core dumped)
sed: can't read spec-00139_rawResults.txt: No such file or directory
sed: can't read spec-00139_rawResults.txt: No such file or directory
Work dir:
/root/work/8c/e6ebc4108dbc902d529873b78827ae
Tip: you can try to figure out what's wrong by changing to the process work dir and showing the script file named `.command.sh`
I'm not sure if I need to install the MS/MS searching engines like comet (the example of STEP2 in demo).
Also, I supported the command lines I used in STEP2, which may give more details:
nextflow run /root/neoflow/neoflow_msms.nf --ms /root/work/example_data/mgf/ --msms_para_file /root/work/example_data/comet_parameter.txt --search_engine comet --db /root/output/customized_database/neoflow_crc_target_decoy.fasta --out_dir /root/output --pv_refdb /root/output/customized_database/ref.fasta --pv_tol 20 --pv_itol 0.05
I am a complete novice in this field and really hope to meet someone to give advice~
Thanks in advance!!!
N E X T F L O W ~ version 19.10.0
Launching neoflow_db.nf
[kickass_mcnulty] - revision: 96dbe17e38
Format input mapping file: /cbio/users/javanokendo/proteogenomics/example_data/test_vcf_files.tsv!
New mapping file: ./test_vcf_files.tsv!
executor > local (1)
[6e/622d9c] process > pre_processing (test_vcf_files.tsv) [100%] 1 of 1, failed: 1 ✘
[- ] process > variant_annotation -
[- ] process > database_construction -
[- ] process > format_db -
[- ] process > generate_decoy_db -
Error executing process > 'pre_processing (test_vcf_files.tsv)'
Caused by:
Process pre_processing (test_vcf_files.tsv)
terminated with an error exit status (255)
Command executed:
#!/usr/bin/env /usr/local/bin/Rscript
library(dplyr)
library(readr)
a = read.delim("/cbio/users/javanokendo/proteogenomics/neoflow/test_vcf_files.tsv")
experiment_names = unique(a[,"experiment"])
for(f in experiment_names){
dat = a %>% filter(experiment == f)
out_file = paste(f,"-mapping_file.tsv",sep="")
write_tsv(dat,out_file)
}
Command exit status:
255
Command output:
(empty)
Command error:
FATAL: could not open image 10158:10011: failed to retrieve path for 10158:10011: lstat 10158:10011: no such file or directory
Work dir:
/cbio/users/javanokendo/proteogenomics/neoflow/work/6e/622d9c1d14877e59caa996bfe306b2
Tip: when you have fixed the problem you can continue the execution adding the option -resume
to the run command line
noeflow_db.nf doesn't allow the -t
flag of customProDBJ
which allows not having reference protein sequences being output. I did a quick fix here and am happy to open a PR.
Btw, sorry that my text editor seems to trim off trailing spaces automatically so the the change looks more than it is.
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.