caleblareau / bap Goto Github PK
View Code? Open in Web Editor NEWBead-based single-cell atac processing
Home Page: http://caleblareau.github.io/bap
License: MIT License
Bead-based single-cell atac processing
Home Page: http://caleblareau.github.io/bap
License: MIT License
Hi, thanks for this awesome tool.
I am getting the error at processing of the bam files
atac.positionsort.MAPQ30.snakemake.log
:
stop_if_wrong_length("'seqnames'", ans_len) :
'seqnames' must have the length of the object to construct (1) or
length 1
Calls: findOverlaps ... makeGRangesFromDataFrame -> GRanges -> new_GRanges -> stop_if_wrong_length
Execution halted
I am using 10x scATAC-seq but the files are processed by another pipeline(scATAC-pro) and not cellranger. This pipeline essentially does the same thing except the barcode flag is probably different in the bam files, so I did not specify the barcode tag. Following was my command:
bap2 bam -i ~/mapping_result/atac.positionsort.MAPQ30.bam -o ~/atac/bap -r hg38 -c 32 -w ~/atac/barcodes.txt
I have attached an entire snakemake log file with the error reported in it. Thanks for your help!
Hello! Thank you for helping me solve the "chrM" error :)
However, I got another error message this time. My scATAC-seq data is prepared by Bio-Rad Surecell ATAC-Seq Library Prep Kit, so I also used bap-barcode to treat the raw fq.gz data. What I have run is:
bap-barcode v2.1 -a test_seqtk_S1_L001_R1_1.fastq.gz -b test_seqtk_S1_L001_R2_1.fastq.gz --nmismatches 1
bwa mem /reference/hg38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna debarcode-c001_1.fastq.gz debarcode-c001_2.fastq.gz | samtools view -bS - | samtools sort -@ 4 - -o debarcode.bam
bap-reanno -i debarcode.bam -o reanno_debarcode.bam
samtools index reanno_debarcode.bam
After I got the reanno_debarcode.bam file, I then run bap2 bam -i reanno_debarcode.bam -o out -r hg38
.
The error in snakemake.log is shown in following:
Error in .subset2(x, i, exact = exact) : subscript out of bounds
Calls: [[ -> [[.data.frame ->
Execution halted
ESC[31mMissingOutputException in line 206 of
/Users/zhangshijing/Documents/scATAC-Seq/bap/bap/bin/snake/Snakefile.bap2.chr:
Job Missing files after 5 seconds:
out/temp/frag_overlap/reanno_debarcode.chr2_overlapCount.rds
out/temp/frag_overlap/reanno_debarcode.chr2_ncCount.tsv
This might be due to filesystem latency. If that is the case, consider to increase the wait time with --latency-wait."
I have converted the bam file, snakemake log information, and the idxstats result of bam file to txt.
reanno_debarcode_snakemake_log.txt
reanno_debarcode_idxstats.txt
reanno_debarcode_bam.txt
Thank you!
Shijing
most obvious place is in the 13_call...R script (maybe add an additional column or something)
Careful to do this right because the jaccard metric can be adapted to get # unique fragments --> important QC metric
Write raw barcode and corrected barcode in FASTQ name comment section when using bap-barcode
https://github.com/caleblareau/bap/wiki/Working-with-BioRad-data
bwa supports the -C
option:
-C | Append append FASTA/Q comment to SAM output. This option can be used to transfer read meta information (e.g. barcode) to the SAM output. Note that the FASTA/Q comment (the string after a space in the header line) must conform the SAM spec (e.g. BC:Z:CGTAC). Malformated comments lead to incorrect SAM output.
This avoid the need to run bap-reanno
afterwards on the BAM, as the tags will be added already by BWA.
# bwa mem: Add -C and -t.
# samtools view: Write uncompressed BAM when converting SAM output to BAM (makes no sense to compress, when sorting it in the next step)
# samtools sort: Put input BAM (-) argument last.
bwa mem -C -t 8 /path/to/hg19.fa debarcode-c001_1.fastq.gz debarcode-c001_2.fastq.gz \
| samtools view -b -u - \
| samtools sort -@ 4 -o debarcode.bam -
samtools index debarcode.bam
Line 7 in 44061cd
This lead to a missing dependency in our internally built conda package metadata that wasn't discovered until runtime.
In step 11,
multiprocessing.pool.MaybeEncodingError: Error sending result:
Because of too many reads
Hi, I got into trouble but have no idea about it when using bap2.
I have 8 libraries, all using the same processes, 2 libraries have few barcodes pass the Knee filtering, like this
And normal libraries like this,
I wondered what may cause this problem? Bad libraries or should I change some parameters (I used default parameters)?
python loop
Should add 3rd column with special names for mito, keep, etc.
requires both ends of the read to be considered. need to run on each bam split by chr individually .
** ABSOLUTELY MAKE THIS PARAMETERIZABLE **
could export the read name, chr, and start during the 11_* script into a plain text format that I could run R on to produce a read name : count vector (through a separate SNAKEMAKE call)
then, in the bam_reannotate in the existing snakemake call, have a second annotation dictionary
Traceback (most recent call last):
File "/usr/local/lib/python3.6/multiprocessing/pool.py", line 119, in worker
result = (True, func(*args, **kwds))
File "/usr/local/lib/python3.6/multiprocessing/pool.py", line 44, in mapstar
return list(map(*args))
File "/home/akohlway/bap/bap/bin/python/11_quantBarcode_Filt.py", line 75, in getUniqueBarcodes
Itr = bam.fetch(str(chrom),multiple_iterators=True)
File "pysam/libcalignmentfile.pyx", line 1066, in pysam.libcalignmentfile.AlignmentFile.fetch
File "pysam/libchtslib.pyx", line 675, in pysam.libchtslib.HTSFile.parse_region
ValueError: invalid contig `chr1`
"""
The above exception was the direct cause of the following exception:
Traceback (most recent call last):
File "/home/akohlway/bap/bap/bin/python/11_quantBarcode_Filt.py", line 182, in <module>
unique_barcodes, all_barcodes = zip(*pool.map(getUniqueBarcodes, chrs))
File "/usr/local/lib/python3.6/multiprocessing/pool.py", line 266, in map
return self._map_async(func, iterable, mapstar, chunksize).get()
File "/usr/local/lib/python3.6/multiprocessing/pool.py", line 644, in get
raise self._value
ValueError: invalid contig `chr1`
Traceback (most recent call last):
File "/home/akohlway/venv3/bin/bap", line 11, in <module>
load_entry_point('bap', 'console_scripts', 'bap')()
File "/home/akohlway/venv3/lib/python3.6/site-packages/click/core.py", line 722, in __call__
return self.main(*args, **kwargs)
File "/home/akohlway/venv3/lib/python3.6/site-packages/click/core.py", line 697, in main
rv = self.invoke(ctx)
File "/home/akohlway/venv3/lib/python3.6/site-packages/click/core.py", line 895, in invoke
return ctx.invoke(self.callback, **ctx.params)
File "/home/akohlway/venv3/lib/python3.6/site-packages/click/core.py", line 535, in invoke
return callback(*args, **kwargs)
File "/home/akohlway/bap/bap/cli.py", line 226, in main
val = file_len(p.output + "/final/" + p.name + ".barcodequants.csv") -1
File "/home/akohlway/bap/bap/bapHelp.py", line 33, in file_len
with open(fname) as f:
FileNotFoundError: [Errno 2] No such file or directory: 'bap_out/final/N719_Exp77_sample15_S1.bap.barcodequants.csv'
via @kohlway1
The pipeline checks that the input bam file is indexed by checking for the .bai
extension, which means that indexes .csi
are not allowed (although they should be).
Lines 145 to 146 in 44061cd
Parameterize it with a file; make it blank when called from command line
Hello,
I am trying to run bap2 on a species mixing dataset. I have successfully loaded the custom genome. How can I specify both the human and mouse mitochondrial (GRCh38_chrM and mm10_chrM) chromosome names in the --mito-chromosome option? I am using the GRCh38/mm10 hybrid genome by 10x (https://support.10xgenomics.com/single-cell-gene-expression/software/release-notes/build#GRCh38mm10_3.1.0).
Kind regards,
Florian
Easiest way -> covert bams into RDS files before reading in for QC report (which you need to change anyways); verify where this gets hung up on workstation
Hi,
I was trying to install the bap package, but I can't. Could you post some information on how to install it?
Thanks!
Sincerely,
Z
bap-barcode v2.1-multi -a fastq_br/biorad_v2-multi_R1.fastq.gz -b fastq_br/biorad_v2-multi_R2.fastq.gz --nmismatches 1
Hello, I was going through the tutorial. I ran the line for the test datasets but the debarcoded files have empty lines. Also in the sumstats.log, it said 0 reads parsed with barcodes.
I was wondering if this is because demo data or this is because the program is not successfully installed at my side.
Need to move toward this as a means of deduplication:
https://software.broadinstitute.org/gatk/documentation/tooldocs/4.0.0.0/picard_sam_markduplicates_UmiAwareMarkDuplicatesWithMateCigar.php
handle more directly up front
in the python script after 11 is called, verify that the output file produces at least one barcode with sufficient quantifications such that it can be considered downstream.
Maybe start log file with this too?
using a .bam
file like N711-Exp31-Sample9.ready2.bam.allele.bam
yields
bap_out/temp/filt_split/N711-Exp31-Sample9.ready2_overlapCount.rds.allele.chr6.bam
Presumably due to the gsub
-like command runnign in snakemake
Hi,
Does the bam file for bap2 input require the reads been duplicates marked, e.g., using Picard to mark the dups but not remove dups? What if I don't run mark dup, the bap2 process will generate some issues, e.g., the jaccard index computations will be too much off?
Thanks a lot!
Yu
[Tue Jul 10 22:59:49 2018] rule reannotate_droplets:
input: Exp100-Sample15_bap/final/Exp100-Sample15.st.barcodeTranslate.tsv, Exp100-Sample15_bap/temp/filt_split/Exp100-Sample15.st.chr20.raw.bam
output: Exp100-Sample15_bap/temp/drop_barcode/Exp100-Sample15.st.chr20.raw.bam, Exp100-Sample15_bap/temp/drop_barcode/Exp100-Sample15.st.chr20.raw.bam.bai
jobid: 5
wildcards: name=Exp100-Sample15.st.chr20.raw
[Tue Jul 10 22:59:49 2018]
[E::bgzf_uncompress] Inflate operation failed: progress temporarily not possible, or in() / out() returned an error
[E::bgzf_read] Read block operation failed with error -1 after 0 of 4 bytes
Finished parsing bam
[Tue Jul 10 22:59:53 2018] Finished job 10.
Potential easy fix: port https://github.com/peterjc/picobio/blob/master/sambam/bgzf_add_eof.py
add new flag to specify peaks; if flag is a valid file, produce a SE counts object
Hi,
I follow the instruction in wiki on how to debarcode the files, and debarcode the Nature Biotech paper, and the success rate is very low, all below 5% which make the processed file very small. Could you take a look on this issue?
`cat *.log
Parsing read pairs:
SRR8994135_1.fastq.gz
SRR8994135_2.fastq.gz
735648 reads parsed with barcodes (1.96% success)
Total reads that failed: 36787203
Of reads that could not be parsed that had valid, detectable constants:
1774 had a bad BC1 barcode sequence
40 had a bad BC2 barcode sequence
122 had a bad BC3 barcode sequence
82 had a bad Tn5 barcode sequence`
-rwxrwxrwx 1 zonghao zonghao 243 Jun 7 14:34 ConvertName.sh -rw-rw-r-- 1 zonghao zonghao 4.0M Jun 8 12:46 debarcode-c001_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 3.3M Jun 8 12:46 debarcode-c001_2.fastq.gz -rw-rw-r-- 1 zonghao zonghao 4.0M Jun 8 13:06 debarcode-c002_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 3.3M Jun 8 13:06 debarcode-c002_2.fastq.gz -rw-rw-r-- 1 zonghao zonghao 4.0M Jun 8 13:26 debarcode-c003_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 3.3M Jun 8 13:26 debarcode-c003_2.fastq.gz -rw-rw-r-- 1 zonghao zonghao 4.0M Jun 8 13:47 debarcode-c004_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 3.3M Jun 8 13:47 debarcode-c004_2.fastq.gz -rw-rw-r-- 1 zonghao zonghao 4.0M Jun 8 14:07 debarcode-c005_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 3.2M Jun 8 14:07 debarcode-c005_2.fastq.gz -rw-rw-r-- 1 zonghao zonghao 4.0M Jun 8 14:28 debarcode-c006_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 3.3M Jun 8 14:28 debarcode-c006_2.fastq.gz -rw-rw-r-- 1 zonghao zonghao 4.0M Jun 8 14:48 debarcode-c007_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 3.3M Jun 8 14:48 debarcode-c007_2.fastq.gz -rw-rw-r-- 1 zonghao zonghao 138K Jun 8 07:42 debarcode-c008_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 119K Jun 8 07:42 debarcode-c008_2.fastq.gz -rw-rw-r-- 1 zonghao zonghao 363 Jun 8 12:27 debarcode-debarcode.sumstats.log -rw-rw-r-- 1 zonghao zonghao 0 Jun 8 12:27 debarcode.stderr.txt -rw------- 1 zonghao zonghao 14K Jun 8 12:27 nohup.out -rw-rw-r-- 1 zonghao zonghao 345 Jun 8 00:50 RunBAPBarcode.sh drwxrwxr-x 2 zonghao zonghao 4.0K Jun 8 01:24 SRR8994127 -rw-rw-r-- 1 zonghao zonghao 555M Jun 7 17:34 SRR8994127_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 251M Jun 7 17:34 SRR8994127_2.fastq.gz drwxrwxr-x 2 zonghao zonghao 4.0K Jun 8 01:56 SRR8994128 -rw-rw-r-- 1 zonghao zonghao 542M Jun 7 17:33 SRR8994128_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 245M Jun 7 17:33 SRR8994128_2.fastq.gz drwxrwxr-x 2 zonghao zonghao 4.0K Jun 8 02:29 SRR8994129 -rw-rw-r-- 1 zonghao zonghao 555M Jun 7 17:34 SRR8994129_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 252M Jun 7 17:34 SRR8994129_2.fastq.gz drwxrwxr-x 2 zonghao zonghao 4.0K Jun 8 03:01 SRR8994130 -rw-rw-r-- 1 zonghao zonghao 558M Jun 7 17:34 SRR8994130_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 253M Jun 7 17:34 SRR8994130_2.fastq.gz drwxrwxr-x 2 zonghao zonghao 4.0K Jun 8 05:22 SRR8994131 -rw-rw-r-- 1 zonghao zonghao 2.3G Jun 7 17:55 SRR8994131_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 1.1G Jun 7 17:55 SRR8994131_2.fastq.gz drwxrwxr-x 2 zonghao zonghao 4.0K Jun 8 07:42 SRR8994132 -rw-rw-r-- 1 zonghao zonghao 2.3G Jun 7 17:55 SRR8994132_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 1.1G Jun 7 17:55 SRR8994132_2.fastq.gz drwxrwxr-x 2 zonghao zonghao 4.0K Jun 8 10:02 SRR8994133 -rw-rw-r-- 1 zonghao zonghao 2.3G Jun 7 17:55 SRR8994133_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 1.1G Jun 7 17:55 SRR8994133_2.fastq.gz drwxrwxr-x 2 zonghao zonghao 4.0K Jun 8 12:27 SRR8994134 -rw-rw-r-- 1 zonghao zonghao 2.3G Jun 7 17:55 SRR8994134_1.fastq.gz -rw-rw-r-- 1 zonghao zonghao 1.1G Jun 7 17:55 SRR8994134_2.fastq.gz
Hello
Following the reading of your bioRxiv paper, I want to test my scAtacSeq datasets.
But my data are on pig, so I need non referent genome.
I was no able to find in the wiki how to add new genome for bap.
Do you have some tutorial ready for that ?
Thank you
As per SM's request (mostly for ATAC/ChIP), the ability to variably threshold cells based on barcode regex. Potential format attached
BeadBarcode DropBarcode OverlapReads
1 cagaattatagttgttcgtac N715_Exp68_sample12_S1_BC02127_N09 42709
2 cagaattattgcctttcgtac N715_Exp68_sample12_S1_BC02127_N09 42709
3 cagaattcatcttattcgtac N715_Exp68_sample12_S1_BC02127_N09 42709
4 cagaattccacttgttcgtac N715_Exp68_sample12_S1_BC02127_N09 42709
5 cagaattcgcggcgttcgtac N715_Exp68_sample12_S1_BC02127_N09 42709
6 cagaattcgtagccttcgtac N715_Exp68_sample12_S1_BC02127_N09 42709
7 cagaattcgtttgattcgtac N715_Exp68_sample12_S1_BC02127_N09 42709
8 cagaattctaactcttcgtac N715_Exp68_sample12_S1_BC02127_N09 42709
9 cagaattctgcgccttcgtac N715_Exp68_sample12_S1_BC02127_N09 42709
UniqueNuclear TotalNuclear TotalMito TotalNC
1 3349 3534 108 34
2 4247 4505 112 46
3 19984 22448 596 158
4 6667 7188 192 51
5 29135 33861 831 207
6 8022 8647 216 57
7 47522 60270 1668 314
8 10193 10992 319 74
9 59317 78918 2109 439
Yields a uniqueNuclearFrags
< 0; pointed out by @zburkett
Not sure what the steps should be to handle it, but this almost certainly a bad barcode set (barcodes only differ by what is in the middle)
Hi, I'm not quite sure how to phrase this question/discussion.
I've performed a timecourse of scATAC-Seq and previously have shown that it demonstrates good temporal progression as viewed from UMAP projections. This is maintained through a variety of different modes of analysis.
Despite these three different peaksets, (190k, 290k, and 373k peaks), the clustering looks pretty identical.
However, when I process all of my samples using bap and merge the resulting bam files, I obtain much less separation between known timepoints. I have inspected the knee plots for bap and it seems fine, and I merge an average of ~10% of my 10X called cells in line with expectations. Even by creating matricies between bap-cells and the identical peaksets, there is a loss of separation. Calling peaks from the new bap cells also looks identical to the previous peaksets. Could this be an artifact of bap? Would how it modifies the aligned reads lead to loss of cell information?
Digging deeper, I tried to identify if there were any clear clusters of bap-merged cells within my non-bap corrected data. There were not. Could you provide insight into why processing via bap is resulting in loss of biological signal?
Hi,
I was using bap-barcode to handle biorad data from your Nature biotechnology paper. For most data, it generates correct fasta file that has the number of lines of generated fiiles are multiple of 4. However for data sets SRR8994134 and SRR8994139, bap-barcode generates a file that the number of lines is not the multiple of 4. Could you help me to see where might the problems come from?
Thanks!
Zonghao
wc -l SRR8994139-c002_1.fastq.gz 539482 SRR8994139-c002_1.fastq.gz
wc -l SRR8994139-c002_2.fastq.gz 342438 SRR8994139-c002_2.fastq.gz
'wc -l SRR8994134-c007_1.fastq.gz
699103 SRR8994134-c007_1.fastq.gz'
'wc -l SRR8994134-c007_2.fastq.gz
466513 SRR8994134-c007_2.fastq.gz'
Hello,
I have an interest in the human/mouse mix data (https://www.ncbi.nlm.nih.gov/sra?term=SRX5124174) in your Nature Biotechnology paper. The fragment.tsv file is not available at GEO unlike other samples in the same paper.
I was wondering if you could share the fragment.tsv file like you did for other samples for example the mouse. Or could you show me how to process the fastq to create the fragment.tsv file.
It has 4 pairs of reads:
SRR8310510_1.fastq.gz SRR8310511_2.fastq.gz SRR8310513_1.fastq.gz
SRR8310510_2.fastq.gz SRR8310512_1.fastq.gz SRR8310513_2.fastq.gz
SRR8310511_1.fastq.gz SRR8310512_2.fastq.gz
I am not clear about how to chain up the steps. For example, I have questions in below:
bap-barcode
?bap-reanno
? What is this command doing? Do I just simply bap-reanno <in_bam> <out_bam>
?bap bam -i
support multiple bam files in the same time? If not, does it mean I will process them one-by-one to generate the fragment.tsv and finally merge all these fragment.tsv files?Many thanks.
Hi, thanks for the nice tool. I would like to use bap-frag tool to generate fragments.tsv from the Bam file. However, I encountered this error as shown below. Could you provide insight into how to fix this? Thanks.
Jason
Fri May 01 17:16:57 HKT 2020: Starting bap-frag pipeline v0.6.5
Traceback (most recent call last):
File "/usr/local/bin/bap-frag", line 11, in <module>
load_entry_point('bap-atac', 'console_scripts', 'bap-frag')()
File "/home/leetl/.local/lib/python3.6/site-packages/click/core.py", line 764, in __call__
return self.main(*args, **kwargs)
File "/home/leetl/.local/lib/python3.6/site-packages/click/core.py", line 717, in main
rv = self.invoke(ctx)
File "/home/leetl/.local/lib/python3.6/site-packages/click/core.py", line 956, in invoke
return ctx.invoke(self.callback, **ctx.params)
File "/home/leetl/.local/lib/python3.6/site-packages/click/core.py", line 555, in invoke
return callback(*args, **kwargs)
File "/home/leetl/bap/bap/cli_bap_frag.py", line 99, in main
bead_tag)
File "/home/leetl/bap/bap/bapFragProjectClass.py", line 72, in __init__
self.bap_version = get_distribution('bap').version
File "/home/leetl/.local/lib/python3.6/site-packages/pkg_resources/__init__.py", line 481, in get_distribution
dist = get_provider(dist)
File "/home/leetl/.local/lib/python3.6/site-packages/pkg_resources/__init__.py", line 357, in get_provider
return working_set.find(moduleOrReq) or require(str(moduleOrReq))[0]
File "/home/leetl/.local/lib/python3.6/site-packages/pkg_resources/__init__.py", line 900, in require
needed = self.resolve(parse_requirements(requirements))
File "/home/leetl/.local/lib/python3.6/site-packages/pkg_resources/__init__.py", line 786, in resolve
raise DistributionNotFound(req, requirers)
pkg_resources.DistributionNotFound: The 'bap' distribution was not found and is required by the application
I encountered two related issues when trying to run the pipeline on my bam files mapped to a custom genome.
Initially, the pipeline was failing to generate *frag.bedpe.annotated.tsv
files for chromosomes that have no reads mapped to them, becaue the empty *frag.bedpe.gz
input files were generating error in the downstream R script.
cell_barcodes.MAPQ30.CB.snakemake.log
After trying to work around this by removing these chromomes from the genome file, the same job still fails, but this time failing to generate the *frag.bedpe.annotated.tsv
for the last file being analyzed, even though the relevan imputs are generated and are not empty. I am quite sure this is not the problem of a particular scaffold or a set of files for it, because when I remove the failing scaffold, I get the same error for the scaffold that is now the last one being processed.
Here is the relevant bit of the log file, and below I attach the whole file as well:
Error in merge.data.table(frags, bead_read, by = "read_name") :
Elements listed in `by` must be valid column names in x and y
Calls: %>% -> na.omit -> merge -> merge -> merge.data.table
Execution halted
gzip: /users/asebe/aelek/proj/scATAC_nvec_Oct20/scATAC_pro/output_50m_PFA/bap2_out/temp/filt_split/cell_barcodes.MAPQ30.CB.scaffold_811.frag.bedpe.
annotated.tsv: No such file or directory
The only idea that I could think of is that this is maybe a latency issue as suggested in the bap log output, and if so, is there a way to run the snakemake pipeline within bap with increased value of --latency-wait
parameter?
Thank you in advance,
Anamaria
Hello! Thank you for the great tool :)
I have a question and I will be grateful if you can help me~
When I run "bap2 bam -i alignment.last.bam -o bap_out -r hg19", I got the following error message.
"""
Traceback (most recent call last):
File "/Users/zhangshijing/anaconda3/lib/python3.7/multiprocessing/pool.py", line 121, in worker
result = (True, func(*args, **kwds))
File "/Users/zhangshijing/anaconda3/lib/python3.7/multiprocessing/pool.py", line 44, in mapstar
return list(map(*args))
File "/Users/zhangshijing/Documents/scATAC-Seq/bap/bap/bin/python/20_names_split_filt.py", line 71, in writeBeadReadName
Itr = bam.fetch(str(chrom),multiple_iterators=True)
File "pysam/libcalignmentfile.pyx", line 1082, in pysam.libcalignmentfile.AlignmentFile.fetch
File "pysam/libchtslib.pyx", line 685, in pysam.libchtslib.HTSFile.parse_region
ValueError: invalid contig chrM
"""
The above exception was the direct cause of the following exception:
Traceback (most recent call last):
File "/Users/zhangshijing/Documents/scATAC-Seq/bap/bap/bin/python/20_names_split_filt.py", line 102, in
toy_out = pool.map(writeBeadReadName, zip(chrs, read_barcode_file))
File "/Users/zhangshijing/anaconda3/lib/python3.7/multiprocessing/pool.py", line 268, in map
return self._map_async(func, iterable, mapstar, chunksize).get()
File "/Users/zhangshijing/anaconda3/lib/python3.7/multiprocessing/pool.py", line 657, in get
raise self._value
ValueError: invalid contig chrM
Thu Mar 04 22:26:13 HKT 2021: Processing bam file using a Snakemake workflow. This is the most computationally intensive step.
Thu Mar 04 22:26:14 HKT 2021: ERROR: Snakemake execution failed. Check bap_out/logs/alignment.last.snakemake.log file for more information. If blank, try allocating more memory.
Before running bap2, I use GATK to remove the "chrM" reads in my bam file. After I see this error, I use "samtools view -h alignment.last.bam | grep -c "chrM"" to check whether there is "chrM" existing in my bam file, and the result shows that there is no "chrM" reads in my bam file.
I have attached the snakemake.log file and the head&tail 100 lines of the alignment.last.bam file.
alignment.last.snakemake.log
alignment_bam_head100.txt
alignment_bam_tail100.txt
Thank you!
Best Wishes,
Shijing
The file barcodeQuantSimple.csv contains the reads compared to mitochondria. If the proportion of mitochondria in the sample or some cells is high, will it cause bad or inaccurate knee curve results? Cellranger uses the peaks after peak calling to analyze the knee, can bap use reads without blacklist and mt region?
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.