Giter VIP home page Giter VIP logo

sangermutantlibraryanalysis's Introduction

SangerMutantLibraryAnalysis

Summary

This is a Python script for analyzing the distribution of mutations among Sanger-sequenced clones in a mutant library of a protein-coding gene. The distributions of mutations are analyzed and plotted.

The script for this analysis is available on GitHub.

This script was written by Jesse Bloom.

Analyses

Here are the analyses (each in its own subdirectory) performed with this script:

  • 2013Analysis_Influenza_NP_Aichi68 contains the results of analyzing a mutant library of the A/Aichi/2/1968 (H3N2) influenza gene. Analysis performed by Jesse Bloom using SangerMutantLibraryAnalysis v0.21.
  • 2014Analysis_Influenza_HA_WSN contains the results of analyzing a mutant library of the A/WSN/1933 (H1N1) influenza gene. Analysis performed by Jesse Bloom using SangerMutantLibraryAnalysis v0.2.
  • 2015Analysis_Influenza_HA_WSN_lowermutationrate contains the results of analyzing additional mutant libraries of the A/WSN/1933 (H1N1) influenza gene after only a single round of mutagenesis to attain a lower overall mutation rate. These analysis are also broken up by replicate library and by cloning vector and the commands used to run the analysis using new command-line argument options are in the file Example_commands.

Requirements

This analysis simply consists of a Python script. It has been tested with Python versions 2.6 and 2.7, and probably works with other 2.* versions as well.

The script requires scipy and matplotlib. It has been tested with scipy 0.12.0 and matplotlib version 1.2.1, but will probably work with other versions as well.

The script uses ImageMagick convert to convert *.pdf files to *.jpg files.

Running the script

The analysis is performed by the script analyze_library.py. To run the script, simply go to the current directory and type the command:

python analyze_library.py

The script will then ask you to enter the names of two input files: the sequence file, and the mutation list file. These are both text files that should have the following format:

  • The sequence file: this is simply a FASTA file that contains a single protein-coding gene. This should be the gene that you are sequencing. For example, here is an example of such a file (WSN-HA.fasta):

    >WSN-HA
    ATGAAGGCAAAACTACTGGTCCTGTTATATGCATTTGTAGCTACAGATGCAGACACAATATGTATAGGCTACCATGCGAACAACTCAACCGACACTGTTGACACAATACTCGAGAAGAATGTGGCAGTGACACATTCTGTTAACCTGCTCGAAGACAGCCACAACGGGAAACTATGTAAATTAAAAGGAATAGCCCCACTACAATTGGGGAAATGTAACATCACCGGATGGCTCTTGGGAAATCCAGAATGCGACTCACTGCTTCCAGCGAGATCATGGTCCTACATTGTAGAAACACCAAACTCTGAGAATGGAGCATGTTATCCAGGAGATCTCATCGACTATGAGGAACTGAGGGAGCAATTGAGCTCAGTATCATCATTAGAAAGATTCGAAATATTTCCCAAGGAAAGTTCATGGCCCAACCACACATTCAACGGAGTAACAGTATCATGCTCCCATAGGGGAAAAAGCAGTTTTTACAGAAATTTGCTATGGCTGACGAAGAAGGGGGATTCATACCCAAAGCTGACCAATTCCTATGTGAACAATAAAGGGAAAGAAGTCCTTGTACTATGGGGTGTTCATCACCCGTCTAGCAGTGATGAGCAACAGAGTCTCTATAGTAATGGAAATGCTTATGTCTCTGTAGCGTCTTCAAATTATAACAGGAGATTCACCCCGGAAATAGCTGCAAGGCCCAAAGTAAGAGATCAACATGGGAGGATGAACTATTACTGGACCTTGCTAGAACCCGGAGACACAATAATATTTGAGGCAACTGGTAATCTAATAGCACCATGGTATGCTTTCGCACTGAGTAGAGGGTTTGAGTCCGGCATCATCACCTCAAACGCGTCAATGCATGAGTGTAACACGAAGTGTCAAACACCCCAGGGAGCTATAAACAGCAATCTCCCTTTCCAGAATATACACCCAGTCACAATAGGAGAGTGCCCAAAATATGTCAGGAGTACCAAATTGAGGATGGTTACAGGACTAAGAAACATCCCATCCATTCAATACAGAGGTCTATTTGGAGCCATTGCTGGTTTTATTGAGGGGGGATGGACTGGAATGATAGATGGATGGTATGGTTATCATCATCAGAATGAACAGGGATCAGGCTATGCAGCGGATCAAAAAAGCACACAAAATGCCATTAACGGGATTACAAACAAGGTGAACTCTGTTATCGAGAAAATGAACACTCAATTCACAGCTGTGGGTAAAGAATTCAACAACTTAGAAAAAAGGATGGAAAATTTAAATAAAAAAGTTGATGATGGGTTTCTGGACATTTGGACATATAATGCAGAATTGTTAGTTCTACTGGAAAATGAAAGGACTTTGGATTTCCATGACTTAAATGTGAAGAATCTGTACGAGAAAGTAAAAAGCCAATTAAAGAATAATGCCAAAGAAATCGGAAATGGGTGTTTTGAGTTCTACCACAAGTGTGACAATGAATGCATGGAAAGTGTAAGAAATGGGACTTATGATTATCCAAAATATTCAGAAGAATCAAAGTTGAACAGGGAAAAGATAGATGGAGTGAAATTGGAATCAATGGGGGTGTATCAGATTCTGGCGATCTACTCAACTGTCGCCAGTTCACTGGTGCTTTTGGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGTTCTAATGGGTCTTTGCAGTGCAGAATATGCATCTGA
    
  • The mutation list file: this is a text file that lists the mutations. The mutations should be numbered in sequential (1, 2, ...) numbering according to the sequence specified in the sequence file. Lines in this file that are empty or begin with the character # are ignored. All other lines should specify a clone and all identified mutations. The clone name should be the first entry on the line, followed by a colon. There is then a comma-delimited list of the mutations. The mutations are indicated as follows:

    • Single nucleotide substitutions are indicated as G1378T for mutation of site 1378 from G to T.
    • Multiple-nucleotide mutations at the same codon should be listed as AG349GA or TCT1003GCC. List mutations like this if they are sequential (or two mutations separated by a single other mutation) as these are probably mutations of the same codon.
    • Deletions should be listed like this: delC392 for deletion of the C at position 392.
    • Insertions should be listed like this: insG392 for insertion of a G at position 392.
    • If a clone has not mutations, you should enter None.

    The script will check that the specified wildtype nucleotides actually match thos e indicated in the sequence file. If they do not, an error will be raised. Note that even if your sequence contains an insertion or deletion, you must ensure that subsequent sites are still numbered according to sequential numbering of the provided sequence.

    Here is an example input file:

    # Sequencing results for 3 WSN-HA mutation libraries.
    # Results from Aug-28 2013 ans Sept-3 2013.
    # Twelve single colonies analyzed for each library replicate with 3 primers.
    # Total 36 samples.
    
    1-1: AAG406GAT, GA1342AG
    1-2: GTA442TAC, AAC667GCT, AAC853GGA
    1-3: ATG1204GTC
    1-4: G373A, G510T
    1-5: AAT118TTG, GGT784CGC, CA1220AT
    1-6: GCA778TAC, TT1019CG, ATA1081GGG, A1370C
    1-7: AGG670TCC, A1232T, delA1544
    1-8: None
    
    1-9: AAT535GAG
    1-10: ACA1150TAC, ATT1171CCG, GTT1192CTA
    1-11: C1175A
    1-12: TC566AT, C855T, C912T
    2-1: CTA172AGG, TC1238AT, T1675G
    2-2: GCT1048CAC
    2-3: AGC472TTT, TAT733CTG, G1070A
    #2-4: mixed template, clearly colony is actually two different mutants
    
    2-5: TCA256CCC, GA832CG, AGG985CGT
    2-6: T818A, G834A, GG1288TC
    2-7: TTC1237AAT
    2-8: GA307CG, T1086A, AG1199GC
    2-9: GGC67CAG, insG1121, AGG1537TAC
    2-10: GG238AC, TGT319CAA, AAG406GAC, C1136A, AA1337TG, GT1621TC
    2-11: A64G, GGG208AAT, ATG727TCA, GG986CC
    2-12: TGT871AAA, TGT1660GAG, TG1690AT
    3-1: G207T
    
    3-2: None
    3-3: ACA1150TAC
    
    3-4: AAC436TAT, T964G, TCT1189GTA
    3-5: GA272TC, TCC1015CAG
    
    3-6: TCA376ACT, T1074G, A1283T
    3-7: G67C
    3-8: GAT514TAG
    
    #3-9: bad sequencing read with forward primer
    3-10: AG625CT, AGC910TTT
    3-11: T606G
    3-12: ATT1162CTA
    

The script will also ask you to enter the codon number of the first codon in the mutagenized region of the gene. This allows specification of an arbitrary start codon for mutagenesis. Codon numbering should follow a (1, 2, ...) numbering scheme, where the first codon in the gene is indexed as codon 1, the second as codon 2, etc. For example, if the entire gene was mutagenized, you should enter 1. However, if the mutagenzied region does not start until codon 25, you should enter 25.

If you don't want to manually type in this information when you run the script, you can provide it on the command line when calling the script as shown below, see Example_commands for examples of how to call the script with all the necessary information provided on the command line.

usage: analyze_library.py [-h] [--outputprefix OUTPUTPREFIX]
[--seqfile SEQFILE] [--mfile MFILE] [--mutstart MUTSTART] [--title TITLE]
optional arguments:
-h, --help show this help message and exit
--outputprefix OUTPUTPREFIX
 optional prefix for output files generated
--seqfile SEQFILE
 name of FASTA file containing the gene sequence
--mfile MFILE name of the file containing the list of mutations
--mutstart MUTSTART
 position of the first codon in the mutated segment of the gene
--title TITLE title for plots generated

Output of the script

The script will print some information about the mutation statistics to standard output. It will also create some PDF plot files. For example, running the script using the example sequence file WSN-HA.fasta and the example mutation list wsn_mutations_090413.txt provided with this script on GitHub will produce the following information printed to standard output:

Beginning analysis.

Enter the name of the FASTA file containing the gene sequence: WSN-HA.fasta
Read a coding sequence of length 1698

Enter the name of the file containing the list of mutations: wsn_mutations_090413.txt

Enter the position of the first codon in the mutated segment of the gene: 1

Reading mutations from wsn_mutations_090413.txt
Read entries for 34 clones

Substitutions begin at following positions: 22, 23, 23, 40, 58, 69, 70, 80, 86, 91, 103, 107, 125, 126, 136, 136, 146, 148, 158, 170, 172, 179, 189, 202, 209, 223, 224, 243, 245, 260, 262, 273, 278, 278, 285, 285, 291, 304, 304, 322, 329, 329, 339, 340, 350, 357, 358, 361, 362, 379, 384, 384, 388, 391, 392, 397, 398, 400, 402, 407, 411, 413, 413, 428, 430, 446, 448, 457, 513, 541, 554, 559, 564

Indels begin at following positions: 374, 515

Found a total of 73 substitutions out of 19244 codons sequenced (0.0038)

Here are the fractions with different numbers of nucleotide mutations:
  1 nucleotide mutations: 0.00104
  2 nucleotide mutations: 0.00145
  3 nucleotide mutations: 0.00130

Here are the fractions of mutation types
  synonymous: 0.00026
  nonsynonymous: 0.00353
  stop codon: 0.00000

Now creating the output PDF plot files...
The output PDF file plots have now all been created.

Script complete

The produced PDF files are as follows:

mutpositions.pdf

The above plot mutpositions.pdf uses lines to show the locations of point mutations and insertions and deletions along the primary sequence.

mutpositions_cumulative.pdf

The above plot mutpositions_cumulative.pdf shows the cumulative distribution of substitution mutations along the primary sequence versus the line expected for a uniform distribution of mutations.

ncodonmuts.pdf

The above plot ncodonmuts.pdf shows the average number of nucleotide changes for each codon substitution mutation versus the expectation if each codon is equally likely to be mutated to every other codon.

nmutdist.pdf

The above plot nmutdist.pdf shows the distribution of the number of codon substitution mutations per clone versus the expectation for a Poisson distribution.

codonmutntcomposition.pdf

The above plot codonmutntcomposition.pdf shows the nucleotide composition (fraction of each of the nucleotides) in the parent and mutant codons for each mutation. If your library is totally unbiased for every codon mutating to every other codon with equal probability, the parent composition should be equal to the nucleotide composition of your gene (which is probably not exactly 25% of each nucleotide), whereas the mutant composition should be very close to 25% of each nucleotide.

mutationclustering.pdf

The above plot mutationclustering.pdf helps you determine if mutations are clustered in primary sequence in clones with multiple substitutions. This plot is less intuitive than the others. For every clone with multiple mutations, the pairwise distance between those mutations in primary sequence is computed. The actual cumulative distribution of these pairwise distances is shown. The script then simulates sets of clones that have the exact same number of mutations per clone as observed in the actual mutation list with these mutations located randomly in primary sequence. It then computes the cumulative distribution of the pairwise distances for 1000 of these simulated libraries, and plots that. If the two distributions look similar, you library probably does not have a tendency for clustering of mutations in primary sequence. If the distributions are different, such clustering may exist.

sangermutantlibraryanalysis's People

Contributors

jbloom avatar mbdoud avatar ajgreaney avatar haddox avatar

Stargazers

Leo Fan avatar  avatar  avatar Lan Xue avatar Abdulrahman Alswaji avatar Gabriel Lencioni Lovate avatar Chris Macdonald avatar Gabrille avatar Akos Nyerges avatar

Watchers

John Huddleston avatar Erick Matsen avatar James Cloos avatar Trevor Bedford avatar  avatar  avatar  avatar  avatar Andrew Butler avatar  avatar Adam Dingens avatar  avatar  avatar  avatar  avatar Kate H. D. Crawford avatar Sarah Hilton avatar Danny Lawrence avatar  avatar Madeleine Duran avatar Juhye Lee avatar

sangermutantlibraryanalysis's Issues

Is there a script a generate "mutation list file"?

The script will then ask you to enter the names of two input files: the sequence file, and the mutation list file. These are both text files that should have the following format

I wonder whether there is a public script to generate "mutation list file" from abl files.
I have tried to write a python script which include parsing, alignment, mutation calling and so on, but there is full of bugs.

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.