Giter VIP home page Giter VIP logo

Comments (1)

mizraelson avatar mizraelson commented on July 18, 2024

Hi,
It seems that the sequences in the table do not fully cover the V gene in many cases and sometimes include either a complete or partial CDR3. To use these sequences, you should first align them to the genome and, using RSS sequences, extract the complete V and J genes. Then, create FASTA files with a list of genes for each gene segment, like this:

>IGHV12-348
GATGCTGGAGTTATCCAGTCACCCCGCCATGAGGTGACAGAGATGGGACAAGAAGTGACTCTGAGATGTAAACCA
ATTTCAGGCCACAACTCCCTTTTCTGGTACAGACAGACCATGATGCGGGGACTGGAGTTGCTCATTTACTTTAAC
AACAACGTTCCGATAGATGATTCAGGGATGCCCGAGGATCGATTCTCAGCTAAGATGCCTAATGCATCATTCTCC
ACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTACTTCTGTGCCAGCAGTTTAGC

To create a TRA library, use a command similar to the one below:

mixcr buildLibrary \
  --v-genes-from-fasta v-genes.TRA.fasta \
  --v-gene-feature VRegion \
  --j-genes-from-fasta j-genes.TRA.fasta \
  --c-genes-from-fasta c-genes.IGH.fasta \ # optional
  --chain TRA \
  --taxon-id 9823 \
  --species pig \
  pig-TRA.json.gz

Next, merge this library with IMGT reference for MiXCR:

mixcr mergeLibrary \
    pig-TRB.json.gz \
    imgt.202214-2.sv8.json.gz \
    my-custom-imgt.json.gz \

Then use the library like this:

mixcr analyze generic-amplicon \
    --library my-custom-imgt \
    --species pig \
    --rna \
    --rigid-left-alignment-boundary \
    --floating-right-alignment-boundary C \
    input_R1.fastq.gz \
    input_R2.fastq.gz \
    output

We also have a dedicated tutorial on this topic.

from mixcr.

Related Issues (20)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.