nf-core / viralrecon Goto Github PK
View Code? Open in Web Editor NEWAssembly and intrahost/low-frequency variant calling for viral samples
Home Page: https://nf-co.re/viralrecon
License: MIT License
Assembly and intrahost/low-frequency variant calling for viral samples
Home Page: https://nf-co.re/viralrecon
License: MIT License
The vcf from iVar has lines that are 100% repeated. I noticed this happens when there are overlapping features on the GFF provided. Is this normal?
If you look at the tsv files you see the difference. Here is one example for the -profile test
run of virarecon:
REGION POS REF ALT REF_DP REF_RV REF_QUAL ALT_DP ALT_RV ALT_QUAL ALT_FREQ TOTAL_DP PVAL PASS GFF_FEATURE REF_CODON REF_AA ALT_CODON
ALT_AA
NC_045512.2 3037 C T 0 0 0 35 7 51 1 35 1.78275e-20 TRUE cds-YP_009724389.1 TTC F TTT F
NC_045512.2 3037 C T 0 0 0 35 7 51 1 35 1.78275e-20 TRUE cds-YP_009725295.1 TTC F TTT F
The only difference is the "GFF-FEATURE" field that is not present in the .vcf file.
The same behaviour is seen in the snpeff .vcf
We create this type of report for researchers, this way they can see at a glance how the experiment worked:
sample | host | Virus sequence | total reads | reads host | % reads host | reads virus | %reads virus | unmapped reads | % unmaped reads | mean DP coverage virus | Coverage > 5x (%) | NumVariantsTrimIVAR | %Nswithoutprimers |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
201397 | human | NC_045512,2 | 2365486 | 23052 | 0,97% | 2335037 | 98,71% | 7397 | 0,3127053 | 15289,14611 | 0,985386 | 5 | 2.50 |
201493 | human | NC_045512,2 | 2077038 | 22299 | 1,07% | 2049058 | 98,65% | 5681 | 0,2735145 | 13671,11417 | 0,997024 | 6 | 0.32 |
201495 | human | NC_045512,2 | 1983106 | 14431 | 0,73% | 1963048 | 98,99% | 5627 | 0,28374681 | 14110,63539 | 0,997893 | 7 | 0.33 |
201575 | human | NC_045512,2 | 2092372 | 4073 | 0,19% | 2080486 | 99,43% | 7813 | 0,37340396 | 14861,83768 | 0,998763 | 7 | 0.34 |
201602 | human | NC_045512,2 | 1821320 | 92766 | 5,09% | 1730140 | 94,99% | -1586 | -0,0870797 | 11835,88687 | 0,992308 | 6 | 2.27 |
201607 | human | NC_045512,2 | 2531506 | 23880 | 0,94% | 2499503 | 98,74% | 8123 | 0,32087619 | 18076,30037 | 0,997458 | 7 | 0.49 |
201617 | human | NC_045512,2 | 2232766 | 10799 | 0,48% | 2212565 | 99,10% | 9402 | 0,42109204 | 16235,09561 | 0,99786 | 3 | 0.32 |
201706 | human | NC_045512,2 | 2642668 | 6370 | 0,24% | 2628133 | 99,45% | 8165 | 0,30896806 | 18056,17594 | 0,998763 | 6 | 0.24 |
201709 | human | NC_045512,2 | 1690968 | 13871 | 0,82% | 1673082 | 98,94% | 4015 | 0,23743796 | 11272,06076 | 0,998595 | 5 | 0.64 |
201738 | human | NC_045512,2 | 2723604 | 3457 | 0,13% | 2708670 | 99,45% | 11477 | 0,42139019 | 18263,53416 | 0,998763 | 2 | 0.32 |
202050 | human | NC_045512,2 | 1366142 | 467391 | 34,21% | 898349 | 65,76% | 402 | 0,02942593 | 5552,181253 | 0,95268 | 5 | 10.35 |
202052 | human | NC_045512,2 | 558458 | 238928 | 42,78% | 167130 | 29,93% | 152400 | 27,2894291 | 913,072902 | 0,946494 | 4 | 14.17 |
Also we have worked in some graphs for the amplicon experiment in order to see how homogeneus the depht of coverage is among amplicons (using bedtools coverage), but a lot of improvement can be done here. And including it as custom content in multiQC is a plus!!
Bowtie2-build requests 16GB of memory which causes the run to crash. I can build the indexes myself, but where do I put the files so that the pipeline does not execute bowtie2-build? Alternatively, how can I customize how bowtie2-build is executed?
Thanks, Jon
I'm going to be working on polyA selected RNA-seq from people with COVID19 and plan to use the Kraken2 indexes generated here: https://genexa.ch/sars2-bioinformatics-resources/
Would like to see optionally pulling viral reads direct from mixed samples.
The label
for each process may or may not have been guestimated for each process. Would be good to test the pipeline on a largeish dataset so we can set sensible defaults. For example, I have uploaded the NF reports here after running -profile test_full
.
execution_trace.txt
execution_timeline.html.txt
execution_report.html.txt
PS: Sorry added a .txt
extension to the html
files because GitHub doesnt like them.
Hi @viralcon people,
I stumbled upon https://www.biorxiv.org/content/10.1101/2020.04.20.052068v1 and it's code https://github.com/niemasd/ViralMSA. I thought this might be interesting for you. Taking a look at the Python script, it would be ideally suited to port it to a Nextflow pipeline.
Be good if we can output IGV screenshots for variants without having to load the BAM files. It can take ages to load these relative to the viral genome due to the high depth. I havent tried it before but would be worth looking into. See here for some docs.
The pipeline currently performs the analysis for these separately but it would be good if we can aggregate these by some sort of SRA id so that they are merged at some point in the pipeline. The functionality to do this would have to be added to this script:
https://github.com/nf-core/viralrecon/blob/dev/bin/check_samplesheet.py
e.g. searching for SRR390277
returns these two SRA entries:
GSM847774: Kc167_Sin3A_ChIPSeq_1 and 2 SRR390277 Illumina Genome Analyzer 10386 15 Dec 2011
GSM847774: Kc167_Sin3A_ChIPSeq_1 and 2 SRR390278 Illumina Genome Analyzer 7910 15 Dec 2011
Hi!
I'm running viralrecon pipeline for a dataset that has to be downloaded from ENA/SRA before the pipeline runs, but it fails.
This is the error:
This is the command:
nextflow run nf-core/viralrecon -r dev --input <path_to>/SRR11140744_metagenomic_sample_sheet.csv --fasta <path_to>/GCF_009858895.2_ASM985889v3_genomic.200409.fna.gz --gff <path_to>/GCF_009858895.2_ASM985889v3_genomic.200409.gff.gz -profile singularity --outdir <path_to_outputdir> --max_cpus 5 --max_memory '16.GB'
And this is the sample sheet:
sample,fastq_1,fastq_2
SRR11140744,,
It seems that the command
md5sum -c SRX7777166_T1_1.fastq.gz.md5
is not working, since there is nothing to check.
Thanks,
Javier
$ nextflow run main.nf -profile test,docker
...
[b2/a44cc7] process > output_documentation [100%] 1 of 1 ✔
Unknown method invocation `toBytes` on String type -- Did you mean?
getBytes
-- Check script 'main.nf' at line: 3457 or see '.nextflow.log' file for more details
We have two separated environments in the two pipelines we have developed, we need to merge them and check that it works.
Dear all,
With our latest batch of data, I was running into several problems.
I am running this:
nextflow run nf-core/viralrecon --input $base/samples.csv --protocol 'amplicon' --amplicon_bed $base/primer/Eden_primers.bed --amplicon_fasta $base/primer/Eden_primers.fa --genome 'MN908947.3' --skip_assembly --outdir $base/results -profile singularity -c dcgc.config -r 1.1.0
I am getting this log:
Caused by:
Process `BCFTOOLS_CONSENSUS (Lib1)` terminated with an error exit status (2)
Command executed:
cat MN908947_nCoV_2019_Wuhan.fa | bcftools consensus Lib1.vcf.gz > Lib1.consensus.fa
bedtools genomecov \
-bga \
-ibam Lib1.trim.mkD.sorted.bam \
-g MN908947_nCoV_2019_Wuhan.fa \
| awk '$4 < 10' | bedtools merge > Lib1.mask.bed
bedtools maskfasta \
-fi Lib1.consensus.fa \
-bed Lib1.mask.bed \
-fo Lib1.consensus.masked.fa
sed -i 's/MN908947_nCoV_2019_Wuhan/Lib1/g' Lib1.consensus.masked.fa
header=$(head -n1 Lib1.consensus.masked.fa | sed 's/>//g')
sed -i "s/${header}/Lib1/g" Lib1.consensus.masked.fa
plot_base_density.r --fasta_files Lib1.consensus.masked.fa --prefixes Lib1 --output_dir ./
Going into the respective work
directory causing the issue, I can find this:
Lib1.vcf.gz
is broken. The directory it is linking to, contains Lib1.vcf
, but not Lib1.vcf.gz
..command.err
shows:terminate called after throwing an instance of 'std::out_of_range'
what(): basic_string::replace: __pos (which is 29902) > this->size() (which is 29899)
<ourpath>/nfcore/work/73/cf65520a401d66d99182767d1315e4/.command.sh: line 13: 2759 Aborted (core dumped) bedtools maskfasta -fi Lib1.consensus.fa -bed Lib1.mask.bed -fo Lib1.consensus.masked.fa
SIGABRT: abort
2a. cat Lib1.mask.bed
MN908947.3 0 39
MN908947.3 4442 6299
MN908947.3 15230 18918
MN908947.3 29847 29869
MN908947.3 29902 29903
2b. cat Lib1.consensus.fa.fai
MN908947.3 29899 12 60 61
After digging a bit, I see that the problem is this. The first command might generate a consensus that is different in length to the original genome due to indels (this has happened in our case). The second command tries to mask the consensus based on coordinates that come from the original genome. Now that the length of the consensus is shorter, there is a clash.
Would you be able to fix this one?
Many thanks in advance
Katrin
Referring to the data posted on zenodo.
I ran this assembly process:
cat sample1_R1.fastq.gz sample1_R2.fastq.gz | pigz >sample1.fastq.gz
minia -kmer-size 47 -abundance-min 20 -in sample1.fastq.gz -out sample1.k47.a20
Using minimap2 I could see an apparent deletion vs. the reference from this assembly. I made a VCF to describe this by generating a variation graph from the assembly and the reference and using vg deconstruct:
cat sample1.k47.a20.contigs.fa ../NC_045512.fa >seqs.fa
minimap2 -w 1 -c -x asm20 ../NC_045512.fa sample1.k47.a20.contigs.fa >seqs.paf
seqwish -s seqs.fa -p seqs.paf -g sample1_vs_ref_k47.a20.gfa
vg convert -x -g sample1_vs_ref_k47.a20.gfa >sample1_vs_ref_k47.a20.xg
vg deconstruct -p NC_045512 sample1_vs_ref_k47.a20.xg
Yielding this VCF:
##fileformat=VCFv4.2
##contig=<ID=NC_045512,length=29903>
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT
NC_045512 75 . CTT CAAAC 23 . .
NC_045512 241 . C T 23 . .
NC_045512 14408 . C T 23 . .
NC_045512 11719 . G A 23 . .
NC_045512 23403 . A G 23 . .
NC_045512 3037 . C T 23 . .
NC_045512 23814 . ATCTTTTGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGC ACA 23 . .
NC_045512 20268 . A G 23 . .
NC_045512 23912 . C A 23 . .
NC_045512 23919 . A C 23 . .
NC_045512 23916 . TC GA 23 . .
To investigate, I aligned (with bwa mem
, default parameters) the read set against this assembly and against the reference NC_045512 sequence. From IGV, I was able to observe that reads match both the reference and deletion allele at this locus.
First, reads against the k47 minia assembly, with the NC_045512 reference at bottom to indicate the precise indel location:
We see some reads mapping across the locus, and some stopping on either side. For some reason, I couldn't find any reads with the same allele as the reference. I think something in the default parameters may be preventing long indels from being detected directly with bwa mem.
Now, inverting things and using NC_045512 as the reference, with the k47 minia assembly at bottom:
Many alignments to the left of the allele show a softclip. Here I'm enabling the display of these sequences:
We can see that the sequence matches the other side of the deletion.
In both cases, it's clear that there are reference-matching reads, although at a lower frequency. There seem to be several things happening here, not just the single deletion that's detected. I'm happy to believe that these are all PCR artifacts, until proven otherwise. It's worth noting that a fraction of the reads do directly support at least one of these possible alleles, without error.
What is going on here?
(I don't see this in the other sample, so I don't think it's directly related to the PCR primer set. I'm assuming that was the same.)
At the moment we have separate processes that run SPAdes
and MetaSPAdes
, however, given that the latter can just be invoked by using the standard spades.py
command with the addition of --meta
it would be nicer if instead we have a single process for SPAdes
and let the user decide which program to use e.g. --spades_assembler metaspades
. We would have to validate these options internally to make sure the correct assembler is provided. Also, this would tie in quite nicely with the option to choose for example the specialist coronaSPAdes assembler where appropriate.
We will have to be careful with this though because the inputs and outputs may change dependng on the assembler that is used. Would need to run them all to test things are working as expected and that we are staging the correct files.
We could also have a --spades_hmm
parameter to provide custom HMM models specific to the virus being investigated.
Much like #4 but this dataset has to be uploaded to nf-core/test-datasets so we can use GitHub Actions CI to perform an end-to-end test of the pipeline for all PRs.
Maybe we can use some of the data @thanhleviet added here for now and then refine as required:
https://github.com/nf-core/test-datasets/tree/covid19
I have created a branch called viralrecon
thats an exact copy of covid19
above:
https://github.com/nf-core/test-datasets/tree/viralrecon
Current handling of SRA/ENA downloads is already robust and multi-tiered.
It could be further improved if primary mode of download used https://en.wikipedia.org/wiki/Fast_and_Secure_Protocol.
Since bin/fetch_sra_runinfo.py
already returns available fasp urls the first download attempt could be ascp, with FTP then parallel-fastq-dump
as fallback.
Although Aspera CLI is proprietary software, it appears that the client comes with a free license.
According to official documentation for an earlier version:
Required Aspera Licenses
• The Aspera CLI requires a Connect-enabled license on the transfer server. For detailed information on your transfer server's license file, see the Aspera Connect Server Admin Guide .
• The Aspera CLI package includes a free client license. It or another valid aspera-license file must be present in the Aspera CLI installation directory
Full license text can be found in the official container under /home/aspera/.aspera/cli/docs/LI_LA_non_ibm_license_en
According to more recent documents, license information is obtained as follows:
docker run --rm -it ibmcom/aspera-cli ascp --version
IBM Aspera CLI version 3.9.1.1401.be67d47
ascp version 3.9.1.167862
Operating System: Linux
FIPS 140-2-validated crypto ready to configure
AES-NI Supported
License max rate=(unlimited), account no.=1, license no.=1
Related notes:
unlhcc/hcc-conda-recipes#8
Edit: potential reason for not going with aspera ncbi/sra-tools#304 (comment)
Depends on nf-core/tools#598
We will need to provide a mechanism by which users can automatically obtain the reference genomes and databases that are specific to this pipeline. It is likely that we will need the host reference as well as the viral reference sequence available. The host reference will already be available in igenomes.config
but we will need to figure out a way of uploading the viral (in this case COVID-19) sequence somewhere so it can just be pulled if not provided by the user. Once we have finalised the files/indices required for the pipeline maybe we can upload this all to AWS iGenomes?
Hello,
I am just trying the test data set using this command
nextflow run nf-core/viralrecon -profile test,singularity
It starts running and downloads the container but then after a while throws this error:
Error executing process > 'get_software_versions'
Caused by:
Process get_software_versions
terminated with an error exit status (132)
Command executed:
echo 1.1.0 > v_pipeline.txt
echo 20.10.0 > v_nextflow.txt
parallel-fastq-dump --version > v_parallel_fastq_dump.txt
fastqc --version > v_fastqc.txt
fastp --version 2> v_fastp.txt
bowtie2 --version > v_bowtie2.txt
samtools --version > v_samtools.txt
bedtools --version > v_bedtools.txt
mosdepth --version > v_mosdepth.txt
picard CollectMultipleMetrics --version &> v_picard.txt || true
ivar -v > v_ivar.txt
echo $(varscan 2>&1) > v_varscan.txt
bcftools -v > v_bcftools.txt
snpEff -version > v_snpeff.txt
echo $(SnpSift 2>&1) > v_snpsift.txt
quast.py --version > v_quast.txt
cutadapt --version > v_cutadapt.txt
kraken2 --version > v_kraken2.txt
spades.py --version > v_spades.txt
unicycler --version > v_unicycler.txt
minia --version > v_minia.txt
blastn -version > v_blast.txt
abacas.pl -v &> v_abacas.txt || true
plasmidID -v > v_plasmidid.txt || true
Bandage --version > v_bandage.txt
minimap2 --version > v_minimap2.txt
vg version > v_vg.txt
echo $(R --version 2>&1) > v_R.txt
multiqc --version > v_multiqc.txt
scrape_software_versions.py &> software_versions_mqc.yaml
Command exit status:
132
Command output:
(empty)
Command error:
This sra toolkit installation has not been configured.
Before continuing, please run: vdb-config --interactive
For more information, see https://www.ncbi.nlm.nih.gov/sra/docs/sra-cloud/
tput: No value for $TERM and no -T specified
tput: No value for $TERM and no -T specified
QStandardPaths: XDG_RUNTIME_DIR not set, defaulting to '/tmp/runtime-joshua.hill'
.command.sh: line 28: 1890 Illegal instruction (core dumped) vg version > v_vg.txt
Work dir:
/home/joshua.hill/work/56/51b8e6286b45f1e3e33b255e3de9ac
Tip: when you have fixed the problem you can continue the execution adding the option -resume
to the run command li
ne
Not sure why this is happening but is this in the singularity container?
This is a generic centos7 machine that it is running on. I have used singularity successfully in the past so I think that installation is correct. I just installed nextflow so maybe it that is not configured correctly.
[joshua.hill@buddy work]$ java -version
openjdk version "1.8.0_282"
OpenJDK Runtime Environment (build 1.8.0_282-b08)
OpenJDK 64-Bit Server VM (build 25.282-b08, mixed mode)
[joshua.hill@buddy work]$ nextflow -v
nextflow version 20.10.0.5430
[joshua.hill@buddy work]$ singularity version
3.7.1-1.el7
Thanks for any help.
It makes sense to implement the extensive functionality offered by IVar
to get from aligned BAM to consensus sequence. Varscan 2
and BCFTools
can still be used for metagenomics data too. We are currently only using it to trim primer sequences so would need to add the other commands as described in the MANUAL.
Also, need to make sure that the parameters we use are applicable to Illumina data too.
It would be nice to be able to generate per-amplicon coverage plots when using --protocol amplicon
in order to assess dropouts/primers that suffer from poor coverage e.g.
The read count per primer sequence is already printed to the log files created by ivar trim
:
Found 196 primers in BED file
Number of references in file: 1
NC_045512.2
Using Region: NC_045512.2
Found 2372934 mapped reads
Found 0 unmapped reads
Sorted By Coordinate
-------
Processed 10% reads ...
Processed 20% reads ...
Processed 30% reads ...
Processed 40% reads ...
Processed 50% reads ...
Processed 60% reads ...
Processed 70% reads ...
Processed 80% reads ...
Processed 90% reads ...
Processed 100% reads ...
-------
Results:
Primer Name Read Count
nCoV-2019_1_LEFT 11671
nCoV-2019_1_RIGHT 11316
nCoV-2019_2_LEFT 5256
nCoV-2019_2_RIGHT 4912
nCoV-2019_3_LEFT 36850
nCoV-2019_3_RIGHT 36308
nCoV-2019_4_LEFT 33741
....
....
@gkarthik would it be sensible to use this information to create these plots? If not, any help, tips or even scripts would be really useful. Thank you!
Would be awesome if we can include the mosdepth amplicon coverage heatmap in the MultiQC report too. Just need to export the matrix from the custom R script we are using by adding a line or two. Can then create custom content for MultiQC to chomp like we are doing in the rnaseq pipeline for the DESeq2 heatmap.
@ewels pointed to some colour codes to get the same palette as in the PDF heatmap:
"Here are the colour codes for the blue-yellow (viridis) colour scale:
https://jarrettmeyer.com/2018/08/07/viridis-color-palette
Get a list of 12 or so of them and set them as the colour_stops config option (or something like that it was, maybe check the docs)"
Given that most of the raw data for this pipeline will be available in publicly available databases such as SRA it would be nice if we can implement functionality to download and process this automatically if SRA ids are provided. I generally recommend that the files are downloaded beforehand to avoid the pipeline crashing during the download. However, I think there may be a good enough case to automate this here or to write a separate script that downloads and checks the data for users before they plug it into the pipeline. I am not fully aware of the complexities when using fastq-dump
, however maybe we can discuss this here?
Nextflow also has a fromSRA()
function that we could use?
Hi there,
A hearty hello from the Serratus project!
https://github.com/ababaian/serratus/
We are keen to work with you guys to integrate viralrecon into our effort to isolate as many distantly-related Coronaviruses as possible.
I'm the resident Kraken2 enthusiast there. Two questions:
Thanks!
picard MarkDuplicates fails to complete when run via Docker on OSX with Nextflow 20.07.1 (works ok when run via Docker on linux with Nextflow 20.10.0)
$ nextflow run main.nf -profile test,docker
...
Error executing process > 'PICARD_MARKDUPLICATES (SAMPLE1_PE)'
Caused by:
Process `PICARD_MARKDUPLICATES (SAMPLE1_PE)` terminated with an error exit status (137)
Command executed:
picard -Xmx6g MarkDuplicates \
INPUT=SAMPLE1_PE.trim.sorted.bam \
OUTPUT=SAMPLE1_PE.trim.mkD.sorted.bam \
ASSUME_SORTED=true \
REMOVE_DUPLICATES=false \
METRICS_FILE=SAMPLE1_PE.trim.mkD.MarkDuplicates.metrics.txt \
VALIDATION_STRINGENCY=LENIENT \
TMP_DIR=tmp
samtools index SAMPLE1_PE.trim.mkD.sorted.bam
samtools idxstats SAMPLE1_PE.trim.mkD.sorted.bam > SAMPLE1_PE.trim.mkD.sorted.bam.idxstats
samtools flagstat SAMPLE1_PE.trim.mkD.sorted.bam > SAMPLE1_PE.trim.mkD.sorted.bam.flagstat
samtools stats SAMPLE1_PE.trim.mkD.sorted.bam > SAMPLE1_PE.trim.mkD.sorted.bam.stats
Command exit status:
137
Command output:
(empty)
Command error:
/opt/conda/envs/nf-core-viralrecon-1.2.0dev/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO 2020-11-28 02:05:00 MarkDuplicates
********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
********** MarkDuplicates -INPUT SAMPLE1_PE.trim.sorted.bam -OUTPUT SAMPLE1_PE.trim.mkD.sorted.bam -ASSUME_SORTED true -REMOVE_DUPLICATES false -METRICS_FILE SAMPLE1_PE.trim.mkD.MarkDuplicates.metrics.txt -VALIDATION_STRINGENCY LENIENT -TMP_DIR tmp
**********
02:05:02.118 INFO NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/opt/conda/envs/nf-core-viralrecon-1.2.0dev/share/picard-2.23.8-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Sat Nov 28 02:05:02 UTC 2020] MarkDuplicates INPUT=[SAMPLE1_PE.trim.sorted.bam] OUTPUT=SAMPLE1_PE.trim.mkD.sorted.bam METRICS_FILE=SAMPLE1_PE.trim.mkD.MarkDuplicates.metrics.txt REMOVE_DUPLICATES=false ASSUME_SORTED=true TMP_DIR=[tmp] VALIDATION_STRINGENCY=LENIENT MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP=50000 MAX_FILE_HANDLES_FOR_READ_ENDS_MAP=8000 SORTING_COLLECTION_SIZE_RATIO=0.25 TAG_DUPLICATE_SET_MEMBERS=false REMOVE_SEQUENCING_DUPLICATES=false TAGGING_POLICY=DontTag CLEAR_DT=true DUPLEX_UMI=false ADD_PG_TAG_TO_READS=true DUPLICATE_SCORING_STRATEGY=SUM_OF_BASE_QUALITIES PROGRAM_RECORD_ID=MarkDuplicates PROGRAM_GROUP_NAME=MarkDuplicates READ_NAME_REGEX=<optimized capture of last three ':' separated fields as numeric values> OPTICAL_DUPLICATE_PIXEL_DISTANCE=100 MAX_OPTICAL_DUPLICATE_SET_SIZE=300000 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Sat Nov 28 02:05:02 UTC 2020] Executing as ?@b9dd687cc9bb on Linux 5.4.39-linuxkit amd64; OpenJDK 64-Bit Server VM 11.0.8-internal+0-adhoc..src; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.23.8
INFO 2020-11-28 02:05:02 MarkDuplicates Start of doWork freeMemory: 15153616; totalMemory: 20971520; maxMemory: 6442450944
INFO 2020-11-28 02:05:02 MarkDuplicates Reading input file and constructing read end information.
INFO 2020-11-28 02:05:02 MarkDuplicates Will retain up to 23342213 data points before spilling to disk.
INFO 2020-11-28 02:05:06 MarkDuplicates Read 48022 records. 10 pairs never matched.
INFO 2020-11-28 02:05:06 MarkDuplicates After buildSortedReadEndLists freeMemory: 150983072; totalMemory: 351272960; maxMemory: 6442450944
INFO 2020-11-28 02:05:06 MarkDuplicates Will retain up to 201326592 duplicate indices before spilling to disk.
INFO 2020-11-28 02:05:12 MarkDuplicates Traversing read pair information and detecting duplicates.
INFO 2020-11-28 02:05:16 MarkDuplicates Traversing fragment information and detecting duplicates.
INFO 2020-11-28 02:05:16 MarkDuplicates Sorting list of duplicate records.
INFO 2020-11-28 02:05:17 MarkDuplicates After generateDuplicateIndexes freeMemory: 1081872920; totalMemory: 2700083200; maxMemory: 6442450944
INFO 2020-11-28 02:05:17 MarkDuplicates Marking 39544 records as duplicates.
INFO 2020-11-28 02:05:17 MarkDuplicates Found 8 optical duplicate clusters.
INFO 2020-11-28 02:05:17 MarkDuplicates Reads are assumed to be ordered by: coordinate
/opt/conda/envs/nf-core-viralrecon-1.2.0dev/bin/picard: line 66: 55 Killed /opt/conda/envs/nf-core-viralrecon-1.2.0dev/bin/java -Xmx6g -jar /opt/conda/envs/nf-core-viralrecon-1.2.0dev/share/picard-2.23.8-0/picard.jar MarkDuplicates "INPUT=SAMPLE1_PE.trim.sorted.bam" "OUTPUT=SAMPLE1_PE.trim.mkD.sorted.bam" "ASSUME_SORTED=true" "REMOVE_DUPLICATES=false" "METRICS_FILE=SAMPLE1_PE.trim.mkD.MarkDuplicates.metrics.txt" "VALIDATION_STRINGENCY=LENIENT" "TMP_DIR=tmp"
Created this issue mostly to address this TODO item
// TODO nf-core: Rename and output gfa files too?
I try to run viralrecon for 86 samples. It seems the pipeline gets stuck and I cannot figure out why. I did run the pipeline on my local machine (14 cores, 128 GB memory) with standard configuration like this:
nextflow run nf-core/viralrecon --input /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//samples.csv --protocol amplicon --amplicon_bed /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//../primer/Eden_processed/Eden_primers.bed --amplicon_fasta /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//../primer/Eden_processed/Eden_primers.fa --genome MN908947.3 --skip_assembly --outdir /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//results -profile singularity -with-singularity /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//singularity.dev.961b10463ae1.sif -r e49cee2
it starts to run, but then it gets stuck without an error and just seems to hang. There is no CPU usage according to htop
. When I run the pipeline on our cluster, distributing jobs with SGE, I get a similar issue. First, I thought it is SGE, but now that the pipeline also gets stuck on my local machine. Getting stuck means, there is no new entry in the log for 1.5 hours now. From the log, I can see that the last jobs were FASTQC jobs. What can I do, do you need more infos? I attach the log.
Jan-29 16:04:40.079 [main] DEBUG nextflow.cli.Launcher - $> nextflow run nf-core/viralrecon --input /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//samples.csv --protocol amplicon --amplicon_bed /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//../primer/Eden_processed/Eden_primers.bed --amplicon_fasta /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//../primer/Eden_processed/Eden_primers.fa --genome MN908947.3 --skip_assembly --outdir /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//results -profile singularity -with-singularity /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//singularity.dev.961b10463ae1.sif -r e49cee2
Jan-29 16:04:40.130 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 20.10.0
Jan-29 16:04:40.824 [main] DEBUG nextflow.scm.AssetManager - Git config: /home/crtd_bioinf/fabirost/.nextflow/assets/nf-core/viralrecon/.git/config; branch: master; remote: origin; url: https://github.com/nf-core/viralrecon.git
Jan-29 16:04:40.835 [main] DEBUG nextflow.scm.AssetManager - Git config: /home/crtd_bioinf/fabirost/.nextflow/assets/nf-core/viralrecon/.git/config; branch: master; remote: origin; url: https://github.com/nf-core/viralrecon.git
Jan-29 16:04:41.024 [main] INFO nextflow.cli.CmdRun - Launching `nf-core/viralrecon` [condescending_volhard] - revision: e49cee2f15dce2e9993736d16f08b1f9d808e292
Jan-29 16:04:41.596 [main] DEBUG nextflow.scm.AssetManager - WARN: Cannot find any Git revision matching: null; ls-remote: [Ref[refs/pull/104/head=e21a9d69c8a80c902e8ed67ead97269ae040daa8], Ref[refs/pull/71/head=de556ff67b80ef002b437391fe3e8ae86ddfcca7], Ref[refs/pull/85/head=cea8613b4a939db7dc36fb639b0b05de07a9aaed], Ref[refs/tags/1.0.0=7422b0d353b1a295fb7cda47f2f7750c3bd890d1], Ref[refs/pull/69/head=b6e20251447dff08ea213605f4bfe554b17a0ab4], Ref[refs/pull/40/head=658104370a3aab1bde5e176750a1ae15687a0b89], Ref[refs/pull/24/head=b77d015ce4720e7447ee6c50fcca8758d16a173e], Ref[refs/pull/135/head=778693daee7a476c8cc9ed1b703bd0e801d42016], Ref[refs/pull/55/head=3bfc2ba5239baa54260a95f031523f4e212451f6], Ref[refs/heads/dsl2=c8f708819bede4b1c8f3840c6355c22b03e6d0e9], Ref[refs/pull/23/head=a87af4acb8a3afe26175da6feeb4c5ca28b3b436], Ref[refs/pull/148/head=9ba237e45aef44056dfd137caf33782252b8c9b2], Ref[refs/pull/120/head=4461c408701db0ba78264092632e45c93f83ba4c], Ref[refs/pull/103/head=372de46851a76d35c038fdf4a80d1207f71de073], Ref[refs/pull/68/head=487df0392fa1579abb9842d33111ebcc6e223d66], Ref[refs/pull/70/head=fb6596249daf33376ca148c6b06a9f2ebb50af8d], Ref[refs/pull/118/head=fb552abe4143334b8b6131028e029a6d9271202a], Ref[refs/pull/150/head=74e32eeb8efa98fea152899ae9e5f43f0aefe087], Ref[refs/pull/38/head=6030094912cb345c1b16584a713c0b94595003e0], Ref[refs/pull/134/head=abcd646b49cd7bccc8e8c4ddf164782731e1eb56], Ref[refs/pull/54/head=4c4103b9fda02bf60c8f77e424ab11d0b783e43e], Ref[refs/pull/99/head=6756a4e3a518e2cac416550168a6b89c57975785], Ref[refs/pull/98/head=afc1fd67c633482675226db3906f9e0ed93ab56f], Ref[refs/pull/84/head=52db59ea24b462f0760896bdeb2f743c85a8b781], Ref[refs/pull/11/head=886c2f681f33e75858deb6e9d1c914fdb299c035], Ref[refs/pull/39/head=0b12a3e4f87ca8f0f83fbde0737466268e15785c], Ref[refs/pull/87/head=d3c56f47a3a51a50a526590901e3f1bfe3db6049], Ref[refs/pull/116/head=e1134ed88cec082d6f7373ba96bfc4e0ecc412bc], Ref[refs/pull/119/head=43c9d78884774bfe5e419014c38cf1e8b31c6710], Ref[refs/pull/41/head=4853f86c0869171b16a53b767401a5a341167e53], Ref[refs/pull/36/head=3eaeb42a7b15701ec7107498e5cdd5866325143c], Ref[refs/pull/52/head=9e511349d7e899310a41fa9b46269571e39034f5], Ref[refs/pull/22/head=a580cfaa886907f4cda826088a15cc8241a99c31], Ref[refs/pull/102/head=1b93695f72a814764cc7dbf74d6a47855042b87a], Ref[refs/pull/25/head=6ebfb8a9d9c42dc06827211f6ef576bdee232efa], Ref[refs/pull/105/head=9a46ba7d317c00e23bdfb889dd1298c33171c99c], Ref[refs/pull/146/head=90079b0fa5d37ffd551c4a9a18cba4f9860a017b], Ref[refs/pull/49/head=fee3c68ef7053fc9bd79a11937320abd056f0948], Ref[refs/pull/88/head=00816d0ec217c4adc2fa38ea07ef882d4dd1c822], Ref[refs/tags/1.1.0=75a2f9763e9b4c1aa20ad342ae3ce148c33cc65a], Ref[refs/pull/140/head=2898d227ba61e2920fc4cc36ed6e5cd14064b7f7], Ref[refs/pull/60/head=eaab9880c914ea28d55f9077005808b9034a60ab], Ref[refs/pull/18/head=23ef7e0cacaa1726777c2a00dd7d138948f99fe8], Ref[refs/pull/82/head=7f8c7988f95c339debce2b3570df0f399fc230e0], Ref[refs/pull/21/head=4a485b793c961d148fae1bbf7f202b49a28307a3], Ref[refs/pull/65/head=3d6512ac4e109958c5fbf719ccbbd14ed9004017], Ref[refs/pull/27/head=775379f647f9e2e41a0dee869dd31d9fef06a9df], Ref[refs/pull/145/head=1ca31f1e8fec66a159e9442c45ccd926d265844e], Ref[refs/pull/43/head=2e5a2b4772239651bd292cbdd1d21fc69c4d1caa], Ref[refs/pull/129/head=7b38fe2439f97927093452232263123e71368d44], Ref[refs/pull/59/head=046d91a78b5c112a93ed7ef7d185c18a19bea8b9], Ref[refs/pull/139/head=60cd93051c5de0af9f79886e48d7c96c6b4ae199], Ref[refs/pull/53/head=ac36d1fcf11674ab8ccf8b77a7bfb414614b9cad], Ref[refs/pull/111/head=69326f97b1c1d1b8733a0df573cb1f3eff907e6d], Ref[refs/pull/136/head=7002a5eb6f481075cf577e7898212bf01144e2f9], Ref[refs/pull/130/head=b0229bbbc6eda0614aa40269a3f06b4edf78c360], Ref[refs/pull/117/head=acfc523f35cb9174c383b01cede82a14c8818688], Ref[refs/pull/133/head=52a1e50ff57cf2295e2de9b425f73f276f20bade], Ref[refs/pull/37/head=55c2a56f7101f4d9bc74fa91cbc6bf9fd81527e2], Ref[refs/pull/114/head=d0e3e179d14b95eb8a1b08c3edcea5012e741206], Ref[refs/pull/34/head=dad04235f8b75dabd385a2e2476a895629549d98], Ref[refs/pull/50/head=fc6eb38364aa85181defa21fb32ba9c56b87bd80], Ref[refs/pull/72/head=3c810f848c21ca58d69aa31b0cecb68889cecebd], Ref[refs/pull/97/head=c6682e57fd58b9ed743e388999c393f2cdaccd78], Ref[refs/pull/78/head=7c38d49a99fd897ac473995c29876c5579e1722d], Ref[refs/pull/91/head=b0f9b52f9d17ba097a518b4dd01e25da52c6159a], Ref[refs/pull/75/head=f9b4b596671b2325011c42734b14239027d62c1d], Ref[refs/pull/94/head=f7004dd083f523674b0b5b7b3d98176b8887b43e], Ref[refs/pull/32/head=cb10b45cadedd90d5da6460704d5cd5f15764c01], Ref[refs/pull/77/head=ed2511444ce83e7924e9fd91584c268251bb2e31], Ref[refs/pull/63/head=4f56a2b91f580fc4f1ff4ff9510bd675b1d512b0], Ref[refs/pull/29/head=634bf562df7712e80ffa57839263273a53b3ae6b], Ref[refs/pull/16/head=79005a50623da53a812584537ee081744631dbe2], Ref[refs/pull/93/head=a495c1c40bd21085c21247ad812e51bcbb90088f], Ref[refs/pull/76/head=8b7285dbb0baa5ee300a43500dbeff782b284134], Ref[refs/pull/15/head=f899da38519e283a12df70fa6f20efd0a851f053], Ref[refs/pull/126/head=13331866195d9b0cc0aee95fc0df881965be7ef3], Ref[refs/pull/62/head=edb5bd0b6f40ac15432d5d234293d39334fd347f], Ref[refs/pull/92/head=ecc1fdcf1dade61baa2f65c2904f88457aa54054], Ref[refs/pull/28/head=c83b9a771430ed9c793e78f4507b6ba50858950b], Ref[refs/pull/81/head=9b4444fc1bb6ea038245dcb57db55ff96161d977], Ref[refs/pull/79/head=d9ad5b9c6f6ee7e1c2e62c36d8df2ef13eecffc1], Ref[refs/pull/44/head=a6524572ebfc9a9b73b1c207d7b56f3c0c37a411], Ref[refs/pull/110/head=9ea4c1a52a0b55beb8fda28d9d5d318c7909a99c], Ref[refs/pull/7/head=053508707e945f883dd611cb6eab89be73f77f56], Ref[refs/pull/127/head=0a7325e0a42b5f06afcb622c74962a3899157eca], Ref[refs/pull/108/head=2622959ec0ca9753ccf35fb57fa38d12a688a4f2], Ref[refs/pull/30/head=8940416aacf0648eeef5fd083cc7cc333d266be4], Ref[refs/pull/17/head=747296441fb64b4bd1137fd8d93f08f91572f90b], Ref[refs/pull/74/head=72d240b1e367193672c4e8914ffd7d51c93fa39b], Ref[HEAD=75a2f9763e9b4c1aa20ad342ae3ce148c33cc65a], Ref[refs/pull/35/head=3781ff8ee824eb0c63644145a48e45221e22de9a], Ref[refs/pull/132/head=5b355cd205b4fa66a6658500d3080481d02bc736], Ref[refs/pull/90/head=b2eef6ca9038df66be27c985372ca1125fc3d8a7], Ref[refs/pull/58/head=5d42f5891d40e249a27a5cc1dcff8e9c13ce78af], Ref[refs/pull/131/head=30db7f95649e6e4f309067f3acb15b86c4499c6d], Ref[refs/pull/20/head=5c7bd7013a253a9785b346f65cf9bfc898da48f6], Ref[refs/pull/137/head=ee5b7b7a47ddabc6b44ef203ce13599ed3e42079], Ref[refs/pull/51/head=6cc01895b3db2901ac33dad5ae2317664467ae35], Ref[refs/pull/19/head=29d89516b218140ce2a5ed4f04c7898d436fc390], Ref[refs/pull/100/head=85f13dd3df92feec87fbe5b367715bb53743067c], Ref[refs/pull/73/head=d07af1ccde076f7010330c1fdd7d60a7b4c6f5be], Ref[refs/pull/96/head=2d5cdb3d8234e7f11c079fe57d8b131010423aae], Ref[refs/pull/57/head=d72c512df8fd38215b8c9bc259a2b97373536ad0], Ref[refs/pull/125/head=c9d40fb3c3f0bf413d593d43c6483f0eca234249], Ref[refs/pull/128/head=eca1bdcdaed5aefaf74402c858a45dc1ba4d123a], Ref[refs/pull/64/head=f27a55065c359cc6f19c4ea8bd7b6d93375a8141], Ref[refs/pull/48/head=e0474ce0f9f7c198f5e49070536b76c70e4b2e0b], Ref[refs/pull/45/head=0687ec1ef98f3ae80c147329c193338d79f537d6], Ref[refs/pull/106/head=160438169ebb0e488fd75f4706dc6fb66888cd7f], Ref[refs/pull/109/head=a5c12fcbbe4ead170ccd13d54b2038406757f271], Ref[refs/heads/TEMPLATE=1ca31f1e8fec66a159e9442c45ccd926d265844e], Ref[refs/heads/dev=e49cee2f15dce2e9993736d16f08b1f9d808e292], Ref[refs/pull/83/head=d9589698b6189d60f996fc722d566f84c28215c2], Ref[refs/pull/86/head=5ac0f286bc4acf243ba7ea53a665fe24ab02f85b], Ref[refs/pull/141/head=052e9a8cdaa1260a6007571b97acc855b7513086], Ref[refs/pull/131/merge=103c74d77174b79e1060b5757209a016c1e26aa6], Ref[refs/heads/master=75a2f9763e9b4c1aa20ad342ae3ce148c33cc65a], Ref[refs/pull/80/head=80a8eb55a94c26d7c488cf0290ff3dc904c3c42d], Ref[refs/pull/89/head=397f25529d0ca506666c88d74a5382fcbbbb481e], Ref[refs/pull/144/head=b006a4187540d86a80981d28c364779ffb2c4aeb], Ref[refs/pull/147/head=80b17e725ec72e03ee63be69187b0f2feb7e8ada]]
Jan-29 16:04:41.629 [main] DEBUG nextflow.config.ConfigBuilder - Found config base: /home/crtd_bioinf/fabirost/.nextflow/assets/nf-core/viralrecon/nextflow.config
Jan-29 16:04:41.630 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /home/crtd_bioinf/fabirost/.nextflow/assets/nf-core/viralrecon/nextflow.config
Jan-29 16:04:41.640 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `singularity`
Jan-29 16:04:42.104 [main] DEBUG nextflow.config.ConfigBuilder - Available config profiles: [cfc_dev, test_sispa, denbi_qbic, bi, genotoul, bigpurple, uppmax, abims, imperial_mb, docker, gis, utd_ganymede, mpcdf, conda, test_full_sispa, singularity, icr_davros, munin, prince, podman, test_sra, czbiohub_aws, hebbe, cfc, uzh, ccga_med, debug, test, genouest, cbe, ebc, ccga_dx, crick, google, kraken, phoenix, seg_globe, shh, awsbatch, pasteur, uct_hpc, imperial, test_full, binac]
Jan-29 16:04:42.116 [main] DEBUG nextflow.config.ConfigBuilder - Enabling execution in Singularity container as requested by cli option `-with-singularity null`
Jan-29 16:04:42.154 [main] DEBUG nextflow.Session - Session uuid: d50953bf-81a8-400d-bca1-9b94a03c8b75
Jan-29 16:04:42.154 [main] DEBUG nextflow.Session - Run name: condescending_volhard
Jan-29 16:04:42.155 [main] DEBUG nextflow.Session - Executor pool size: 28
Jan-29 16:04:42.172 [main] DEBUG nextflow.cli.CmdRun -
Version: 20.10.0 build 5430
Created: 01-11-2020 15:14 UTC (16:14 CEST)
System: Linux 5.4.0-58-generic
Runtime: Groovy 3.0.5 on OpenJDK 64-Bit Server VM 11.0.8-internal+0-adhoc..src
Encoding: UTF-8 (UTF-8)
Process: 3558564@cbioinfws1 [127.0.1.1]
CPUs: 28 - Mem: 125.5 GB (47.1 GB) - Swap: 14 GB (13.9 GB)
Jan-29 16:04:42.187 [main] DEBUG nextflow.Session - Work-dir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work [zfs]
Jan-29 16:04:42.230 [main] DEBUG nextflow.Session - Observer factory: TowerFactory
Jan-29 16:04:42.234 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory
Jan-29 16:04:42.408 [main] DEBUG nextflow.Session - Session start invoked
Jan-29 16:04:42.411 [main] DEBUG nextflow.trace.TraceFileObserver - Flow starting -- trace file: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/results/pipeline_info/execution_trace.txt
Jan-29 16:04:45.536 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution
Jan-29 16:04:45.543 [main] DEBUG nextflow.Session - Workflow process names [dsl1]: MOSDEPTH_GENOME, UNICYCLER_PLASMIDID, UNICYCLER_SNPEFF, MINIA_BLAST, output_documentation, UNICYCLER_VG, IVAR_CONSENSUS, SORT_BAM, FASTP, SRA_FASTQ_FTP, UNICYCLER_ABACAS, PICARD_MARKDUPLICATES, MINIA, VARSCAN2, BCFTOOLS_CONSENSUS, CAT_FASTQ, METASPADES_SNPEFF, GUNZIP_GFF, SPADES_VG, UNICYCLER_QUAST, PICARD_METRICS, KRAKEN2, SPADES_PLASMIDID, METASPADES_QUAST, BCFTOOLS_VARIANTS, BCFTOOLS_SNPEFF, MAKE_BLAST_DB, MOSDEPTH_AMPLICON, METASPADES, IVAR_VARIANTS, FASTQC, BOWTIE2_INDEX, SPADES, METASPADES_VG, SPADES_ABACAS, METASPADES_PLASMIDID, SPADES_SNPEFF, UNICYCLER, MULTIQC, CUTADAPT, KRAKEN2_BUILD, IVAR_TRIM, IVAR_QUAST, UNICYCLER_BLAST, VARSCAN2_QUAST, METASPADES_ABACAS, MINIA_VG, MINIA_ABACAS, get_software_versions, SPADES_BLAST, MINIA_SNPEFF, SPADES_QUAST, MAKE_SNPEFF_DB, BCFTOOLS_QUAST, SAMTOOLS_MPILEUP, GUNZIP_FASTA, METASPADES_BLAST, BCFTOOLS_ISEC, VARSCAN2_SNPEFF, MINIA_QUAST, UNTAR_KRAKEN2_DB, MOSDEPTH_AMPLICON_PLOT, SRA_FASTQ_DUMP, MINIA_PLASMIDID, BOWTIE2, IVAR_SNPEFF, CHECK_SAMPLESHEET, VARSCAN2_CONSENSUS
Jan-29 16:04:45.772 [main] INFO nextflow.Nextflow - ----------------------------------------------------
,--./,-.
___ __ __ __ ___ /,-._.--~'
|\ | |__ __ / ` / \ |__) |__ } {
| \| | \__, \__/ | \ |___ \`-._,-`-,
`._,._,'
nf-core/viralrecon v1.2.0dev
----------------------------------------------------
Jan-29 16:04:45.775 [main] INFO nextflow.Nextflow - Run Name : condescending_volhard
Samplesheet : /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//samples.csv
Protocol : amplicon
Amplicon Fasta File : /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//../primer/Eden_processed/Eden_primers.fa
Amplicon BED File : /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//../primer/Eden_processed/Eden_primers.bed
Amplicon Left Suffix : _LEFT
Amplicon Right Suffix : _RIGHT
Viral Genome : MN908947.3
Viral Fasta File : https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/genome/MN908947.3/GCA_009858895.3_ASM985889v3_genomic.200409.fna.gz
Viral GFF : https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/genome/MN908947.3/GCA_009858895.3_ASM985889v3_genomic.200409.gff.gz
Fastp Mean Qual : 30
Fastp Qual Phred : 30
Fastp Unqual % Limit : 10
Fastp Min Trim Length : 50
Variant Calling Tools : varscan2,ivar,bcftools
Min Mapped Reads : 1000
iVar Trim Min Len : 20
iVar Trim Min Qual : 20
iVar Trim Window : 4
Mpileup Depth : 0
Min Base Quality : 20
Min Read Depth : 10
Min Allele Freq : 0.25
Max Allele Freq : 0.75
Varscan2 Strand Filter: Yes
Skip Kraken2 : Yes
Skip Assembly : Yes
Max Resources : 128.GB memory, 16 cpus, 240.h time per job
Container : singularity - /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//singularity.dev.961b10463ae1.sif
Output dir : /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore//results
Publish dir mode : copy
Launch dir : /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore
Working dir : /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work
Script dir : /home/crtd_bioinf/fabirost/.nextflow/assets/nf-core/viralrecon
User : fabirost
Config Profile : singularity
Jan-29 16:04:45.775 [main] INFO nextflow.Nextflow - ----------------------------------------------------
Jan-29 16:04:45.814 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_retry` matches label `error_retry` for process with name GUNZIP_FASTA
Jan-29 16:04:45.816 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:45.816 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:45.820 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local
Jan-29 16:04:45.824 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=28; memory=125.5 GB; capacity=28; pollInterval=100ms; dumpInterval=5m
Jan-29 16:04:46.130 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_retry` matches label `error_retry` for process with name GUNZIP_GFF
Jan-29 16:04:46.132 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.132 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.137 [Actor Thread 3] DEBUG n.util.BlockingThreadExecutorFactory - Thread pool name=FileTransfer; maxThreads=84; maxQueueSize=252; keepAlive=1m
Jan-29 16:04:46.148 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.148 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.148 [FileTransfer-thread-1] DEBUG nextflow.file.FilePorter - Copying foreign file https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/genome/MN908947.3/GCA_009858895.3_ASM985889v3_genomic.200409.fna.gz to work dir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/stage/d4/6f01f2da9b3e9df329929a24dab4e4/GCA_009858895.3_ASM985889v3_genomic.200409.fna.gz
Jan-29 16:04:46.216 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name SRA_FASTQ_FTP
Jan-29 16:04:46.217 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_retry` matches label `error_retry` for process with name SRA_FASTQ_FTP
Jan-29 16:04:46.217 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.217 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.227 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name SRA_FASTQ_DUMP
Jan-29 16:04:46.227 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_retry` matches label `error_retry` for process with name SRA_FASTQ_DUMP
Jan-29 16:04:46.228 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.228 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.244 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.244 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.249 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name FASTQC
Jan-29 16:04:46.250 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.250 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.255 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name FASTP
Jan-29 16:04:46.255 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.255 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.261 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name BOWTIE2_INDEX
Jan-29 16:04:46.261 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.261 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.265 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_low` matches label `process_low` for process with name MAKE_SNPEFF_DB
Jan-29 16:04:46.266 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.266 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.276 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name BOWTIE2
Jan-29 16:04:46.277 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.277 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.283 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name SORT_BAM
Jan-29 16:04:46.284 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.284 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.292 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name IVAR_TRIM
Jan-29 16:04:46.292 [FileTransfer-thread-2] DEBUG nextflow.file.FilePorter - Copying foreign file https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/genome/MN908947.3/GCA_009858895.3_ASM985889v3_genomic.200409.gff.gz to work dir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/stage/65/d4783068a1abebd25f22a3dc83edcd/GCA_009858895.3_ASM985889v3_genomic.200409.gff.gz
Jan-29 16:04:46.292 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.292 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.297 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name PICARD_MARKDUPLICATES
Jan-29 16:04:46.298 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.298 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.303 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name PICARD_METRICS
Jan-29 16:04:46.303 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.303 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.307 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:46.307 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name MOSDEPTH_GENOME
Jan-29 16:04:46.308 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.308 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.310 [Task submitter] INFO nextflow.Session - [02/05e8a9] Submitted process > CHECK_SAMPLESHEET (samples.csv)
Jan-29 16:04:46.314 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name MOSDEPTH_AMPLICON
Jan-29 16:04:46.314 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.314 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.321 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name MOSDEPTH_AMPLICON_PLOT
Jan-29 16:04:46.321 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.321 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.324 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name SAMTOOLS_MPILEUP
Jan-29 16:04:46.325 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.325 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.329 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name VARSCAN2
Jan-29 16:04:46.330 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.330 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.336 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:46.336 [Task submitter] INFO nextflow.Session - [0e/cd6472] Submitted process > GUNZIP_FASTA
Jan-29 16:04:46.339 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name VARSCAN2_CONSENSUS
Jan-29 16:04:46.340 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.340 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.346 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name VARSCAN2_SNPEFF
Jan-29 16:04:46.346 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.346 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.351 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name VARSCAN2_QUAST
Jan-29 16:04:46.351 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.352 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.358 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name IVAR_VARIANTS
Jan-29 16:04:46.358 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.358 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.364 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name IVAR_CONSENSUS
Jan-29 16:04:46.364 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.364 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.368 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name IVAR_SNPEFF
Jan-29 16:04:46.368 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.368 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.372 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name IVAR_QUAST
Jan-29 16:04:46.373 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.373 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.376 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name BCFTOOLS_VARIANTS
Jan-29 16:04:46.376 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.376 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.381 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name BCFTOOLS_CONSENSUS
Jan-29 16:04:46.381 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.381 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.384 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name BCFTOOLS_SNPEFF
Jan-29 16:04:46.385 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.385 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.388 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name BCFTOOLS_QUAST
Jan-29 16:04:46.388 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.388 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.393 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name BCFTOOLS_ISEC
Jan-29 16:04:46.393 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name BCFTOOLS_ISEC
Jan-29 16:04:46.393 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.393 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.396 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name MAKE_BLAST_DB
Jan-29 16:04:46.396 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.396 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.398 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:46.400 [Task submitter] INFO nextflow.Session - [e1/00bc46] Submitted process > GUNZIP_GFF
Jan-29 16:04:46.401 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_high` matches label `process_high` for process with name SPADES
Jan-29 16:04:46.401 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name SPADES
Jan-29 16:04:46.402 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.402 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.405 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name SPADES_BLAST
Jan-29 16:04:46.405 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name SPADES_BLAST
Jan-29 16:04:46.406 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.406 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.409 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name SPADES_ABACAS
Jan-29 16:04:46.409 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name SPADES_ABACAS
Jan-29 16:04:46.409 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.409 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.413 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name SPADES_PLASMIDID
Jan-29 16:04:46.413 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name SPADES_PLASMIDID
Jan-29 16:04:46.413 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.413 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.418 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name SPADES_QUAST
Jan-29 16:04:46.418 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name SPADES_QUAST
Jan-29 16:04:46.418 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.418 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.423 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name SPADES_VG
Jan-29 16:04:46.423 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name SPADES_VG
Jan-29 16:04:46.423 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.423 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.426 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name SPADES_SNPEFF
Jan-29 16:04:46.427 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name SPADES_SNPEFF
Jan-29 16:04:46.427 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.427 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.430 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_high` matches label `process_high` for process with name METASPADES
Jan-29 16:04:46.431 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name METASPADES
Jan-29 16:04:46.431 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.431 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.434 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name METASPADES_BLAST
Jan-29 16:04:46.434 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name METASPADES_BLAST
Jan-29 16:04:46.434 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.434 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.438 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name METASPADES_ABACAS
Jan-29 16:04:46.438 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name METASPADES_ABACAS
Jan-29 16:04:46.438 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.438 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.442 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name METASPADES_PLASMIDID
Jan-29 16:04:46.442 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name METASPADES_PLASMIDID
Jan-29 16:04:46.443 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.443 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.446 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name METASPADES_QUAST
Jan-29 16:04:46.446 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name METASPADES_QUAST
Jan-29 16:04:46.447 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.447 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.451 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name METASPADES_VG
Jan-29 16:04:46.451 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name METASPADES_VG
Jan-29 16:04:46.451 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.451 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.454 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name METASPADES_SNPEFF
Jan-29 16:04:46.455 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name METASPADES_SNPEFF
Jan-29 16:04:46.455 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.455 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.458 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_high` matches label `process_high` for process with name UNICYCLER
Jan-29 16:04:46.458 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name UNICYCLER
Jan-29 16:04:46.458 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.458 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.462 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name UNICYCLER_BLAST
Jan-29 16:04:46.462 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name UNICYCLER_BLAST
Jan-29 16:04:46.463 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.463 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.467 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name UNICYCLER_ABACAS
Jan-29 16:04:46.468 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name UNICYCLER_ABACAS
Jan-29 16:04:46.468 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.468 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.472 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name UNICYCLER_PLASMIDID
Jan-29 16:04:46.473 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name UNICYCLER_PLASMIDID
Jan-29 16:04:46.473 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.473 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.476 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name UNICYCLER_QUAST
Jan-29 16:04:46.477 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name UNICYCLER_QUAST
Jan-29 16:04:46.477 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.477 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.481 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name UNICYCLER_VG
Jan-29 16:04:46.481 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name UNICYCLER_VG
Jan-29 16:04:46.481 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.481 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.485 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name UNICYCLER_SNPEFF
Jan-29 16:04:46.485 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name UNICYCLER_SNPEFF
Jan-29 16:04:46.485 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.485 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.489 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_high` matches label `process_high` for process with name MINIA
Jan-29 16:04:46.489 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name MINIA
Jan-29 16:04:46.489 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.489 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.493 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name MINIA_BLAST
Jan-29 16:04:46.493 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name MINIA_BLAST
Jan-29 16:04:46.493 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.493 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.496 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name MINIA_ABACAS
Jan-29 16:04:46.496 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name MINIA_ABACAS
Jan-29 16:04:46.496 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.496 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.500 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name MINIA_PLASMIDID
Jan-29 16:04:46.500 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name MINIA_PLASMIDID
Jan-29 16:04:46.500 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.500 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.503 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name MINIA_QUAST
Jan-29 16:04:46.504 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name MINIA_QUAST
Jan-29 16:04:46.504 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.504 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.507 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name MINIA_VG
Jan-29 16:04:46.507 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name MINIA_VG
Jan-29 16:04:46.508 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.508 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.511 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name MINIA_SNPEFF
Jan-29 16:04:46.511 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:error_ignore` matches label `error_ignore` for process with name MINIA_SNPEFF
Jan-29 16:04:46.511 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.511 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.524 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withName:get_software_versions` matches process get_software_versions
Jan-29 16:04:46.524 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.524 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.555 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:46.555 [Task submitter] INFO nextflow.Session - [99/ab7350] Submitted process > get_software_versions
Jan-29 16:04:46.586 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:process_medium` matches label `process_medium` for process with name MULTIQC
Jan-29 16:04:46.587 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.587 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.597 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: null
Jan-29 16:04:46.598 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Jan-29 16:04:46.602 [main] DEBUG nextflow.script.ScriptRunner - > Await termination
Jan-29 16:04:46.602 [main] DEBUG nextflow.Session - Session await
Jan-29 16:04:46.611 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:46.613 [Task submitter] INFO nextflow.Session - [3f/dfd1ac] Submitted process > output_documentation
Jan-29 16:04:46.702 [Actor Thread 4] DEBUG nextflow.sort.BigSort - Sort completed -- entries: 1; slices: 1; internal sort time: 0.001 s; external sort time: 0.011 s; total time: 0.012 s
Jan-29 16:04:46.713 [Actor Thread 4] DEBUG nextflow.file.FileCollector - Saved collect-files list to: /tmp/8318f1e9fe9f83c0c4c05c6503d98304.collect-file
Jan-29 16:04:46.719 [Actor Thread 4] DEBUG nextflow.file.FileCollector - Deleting file collector temp dir: /tmp/nxf-14007747180325198031
Jan-29 16:04:46.776 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: GUNZIP_FASTA; status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/0e/cd64726e576234d6afd243e60470a4]
Jan-29 16:04:46.813 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:46.813 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 2; name: GUNZIP_GFF; status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/e1/00bc46cbdd23a0a62eeddc73ee8b94]
Jan-29 16:04:46.813 [Task submitter] INFO nextflow.Session - [2b/435f49] Submitted process > BOWTIE2_INDEX (GCA_009858895.3_ASM985889v3_genomic.200409.fna)
Jan-29 16:04:46.829 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:46.829 [Task submitter] INFO nextflow.Session - [22/49fc18] Submitted process > MAKE_SNPEFF_DB (GCA_009858895.3_ASM985889v3_genomic.200409.fa)
Jan-29 16:04:46.854 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 3; name: CHECK_SAMPLESHEET (samples.csv); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/02/05e8a99959b4753cc597633450f804]
Jan-29 16:04:46.856 [Task monitor] DEBUG nextflow.processor.TaskProcessor - Process `CHECK_SAMPLESHEET (samples.csv)` is unable to find [UnixPath]: `/home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/02/05e8a99959b4753cc597633450f804/sra_run_info.tsv` (pattern: `sra_run_info.tsv`)
Jan-29 16:04:46.942 [Task monitor] DEBUG nextflow.processor.TaskProcessor - Process CHECK_SAMPLESHEET > Skipping output binding because one or more optional files are missing: fileoutparam<1>
Jan-29 16:04:47.261 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.261 [Task submitter] INFO nextflow.Session - [9d/c9edcd] Submitted process > CAT_FASTQ (L66086_EdenPool_Covid-DD-VIR-00218)
Jan-29 16:04:47.368 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.368 [Task submitter] INFO nextflow.Session - [c9/38ae42] Submitted process > CAT_FASTQ (L66089_EdenPool_Covid-DD-VIR-00225)
Jan-29 16:04:47.372 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.372 [Task submitter] INFO nextflow.Session - [23/47d98a] Submitted process > CAT_FASTQ (L66099_EdenPool_Covid-DD-VIR-00243)
Jan-29 16:04:47.377 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.378 [Task submitter] INFO nextflow.Session - [b6/c5cc2e] Submitted process > CAT_FASTQ (L66075_EdenPool_Covid-DD-VIR-00203)
Jan-29 16:04:47.382 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.383 [Task submitter] INFO nextflow.Session - [10/4619d2] Submitted process > CAT_FASTQ (L66084_EdenPool_Covid-DD-VIR-00213)
Jan-29 16:04:47.388 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.389 [Task submitter] INFO nextflow.Session - [7b/ee6817] Submitted process > CAT_FASTQ (L66080_EdenPool_Covid-DD-VIR-00209)
Jan-29 16:04:47.394 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.394 [Task submitter] INFO nextflow.Session - [53/5de058] Submitted process > CAT_FASTQ (L66083_EdenPool_Covid-DD-VIR-00212)
Jan-29 16:04:47.481 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 7; name: BOWTIE2_INDEX (GCA_009858895.3_ASM985889v3_genomic.200409.fna); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/2b/435f49b16c5b5dcc5d9a8ca1dfd157]
Jan-29 16:04:47.488 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.489 [Task submitter] INFO nextflow.Session - [dd/794e12] Submitted process > CAT_FASTQ (L66093_EdenPool_Covid-DD-VIR-00235)
Jan-29 16:04:47.495 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.495 [Task submitter] INFO nextflow.Session - [d2/0ab361] Submitted process > CAT_FASTQ (L66091_EdenPool_Covid-DD-VIR-00229)
Jan-29 16:04:47.498 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.499 [Task submitter] INFO nextflow.Session - [5b/808949] Submitted process > CAT_FASTQ (L66082_EdenPool_Covid-DD-VIR-00211)
Jan-29 16:04:47.503 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.505 [Task submitter] INFO nextflow.Session - [0f/a9d31b] Submitted process > CAT_FASTQ (L66100_EdenPool_Covid-DD-VIR-00244)
Jan-29 16:04:47.509 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.509 [Task submitter] INFO nextflow.Session - [91/da743d] Submitted process > CAT_FASTQ (L66095_EdenPool_Covid-DD-VIR-00237)
Jan-29 16:04:47.513 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.513 [Task submitter] INFO nextflow.Session - [81/4f7d3a] Submitted process > CAT_FASTQ (L66078_EdenPool_Covid-DD-VIR-00207)
Jan-29 16:04:47.578 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 5; name: output_documentation; status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/3f/dfd1ac62f7ef2fb814e8b064d80f69]
Jan-29 16:04:47.582 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.583 [Task submitter] INFO nextflow.Session - [fc/9de7d1] Submitted process > CAT_FASTQ (L66088_EdenPool_Covid-DD-VIR-00221)
Jan-29 16:04:47.628 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 21; name: CAT_FASTQ (L66086_EdenPool_Covid-DD-VIR-00218); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/9d/c9edcdd2549682ed2c4b8e90962be0]
Jan-29 16:04:47.633 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:47.633 [Task submitter] INFO nextflow.Session - [35/b68bc5] Submitted process > CAT_FASTQ (L66090_EdenPool_Covid-DD-VIR-00226)
Jan-29 16:04:48.048 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 34; name: CAT_FASTQ (L66099_EdenPool_Covid-DD-VIR-00243); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/23/47d98a6a017a12cec1f39351ec4f4e]
Jan-29 16:04:48.052 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.052 [Task submitter] INFO nextflow.Session - [21/f7ef2c] Submitted process > CAT_FASTQ (L66094_EdenPool_Covid-DD-VIR-00236)
Jan-29 16:04:48.089 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 15; name: CAT_FASTQ (L66080_EdenPool_Covid-DD-VIR-00209); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/7b/ee681796965d59b6601a420e6b9705]
Jan-29 16:04:48.093 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.101 [Task submitter] INFO nextflow.Session - [8c/eb1e12] Submitted process > CAT_FASTQ (L66097_EdenPool_Covid-DD-VIR-00240)
Jan-29 16:04:48.169 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 24; name: CAT_FASTQ (L66089_EdenPool_Covid-DD-VIR-00225); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/c9/38ae42802f24319657933d43c11a88]
Jan-29 16:04:48.172 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.173 [Task submitter] INFO nextflow.Session - [15/592959] Submitted process > CAT_FASTQ (L66077_EdenPool_Covid-DD-VIR-00206)
Jan-29 16:04:48.175 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 10; name: CAT_FASTQ (L66075_EdenPool_Covid-DD-VIR-00203); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/b6/c5cc2eaa84bde00df51f2b9defdaaf]
Jan-29 16:04:48.180 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.180 [Task submitter] INFO nextflow.Session - [96/91d0cf] Submitted process > CAT_FASTQ (L66076_EdenPool_Covid-DD-VIR-00205)
Jan-29 16:04:48.209 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 20; name: CAT_FASTQ (L66084_EdenPool_Covid-DD-VIR-00213); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/10/4619d25993a419d6bf78914274350b]
Jan-29 16:04:48.216 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 18; name: CAT_FASTQ (L66083_EdenPool_Covid-DD-VIR-00212); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/53/5de058b8baff74a31723f581bac17f]
Jan-29 16:04:48.217 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.218 [Task submitter] INFO nextflow.Session - [9a/86c686] Submitted process > CAT_FASTQ (L66098_EdenPool_Covid-DD-VIR-00241)
Jan-29 16:04:48.227 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.227 [Task submitter] INFO nextflow.Session - [9c/76507b] Submitted process > CAT_FASTQ (L66079_EdenPool_Covid-DD-VIR-00208)
Jan-29 16:04:48.329 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 28; name: CAT_FASTQ (L66093_EdenPool_Covid-DD-VIR-00235); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/dd/794e1280831b70961b7616298e8de4]
Jan-29 16:04:48.332 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.332 [Task submitter] INFO nextflow.Session - [38/1fbe20] Submitted process > CAT_FASTQ (L66081_EdenPool_Covid-DD-VIR-00210)
Jan-29 16:04:48.417 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 26; name: CAT_FASTQ (L66091_EdenPool_Covid-DD-VIR-00229); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/d2/0ab3613df6a009215572ea4b8bf876]
Jan-29 16:04:48.423 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.424 [Task submitter] INFO nextflow.Session - [e5/7db6cd] Submitted process > CAT_FASTQ (L66092_EdenPool_Covid-DD-VIR-00231)
Jan-29 16:04:48.516 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 17; name: CAT_FASTQ (L66082_EdenPool_Covid-DD-VIR-00211); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/5b/80894983db70c8227739ee8f242635]
Jan-29 16:04:48.519 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.519 [Task submitter] INFO nextflow.Session - [81/23ed74] Submitted process > CAT_FASTQ (L66074_EdenPool_Covid-DD-VIR-00201)
Jan-29 16:04:48.730 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 30; name: CAT_FASTQ (L66095_EdenPool_Covid-DD-VIR-00237); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/91/da743ddc120f3302595b241ec606a4]
Jan-29 16:04:48.732 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.732 [Task submitter] INFO nextflow.Session - [a4/5d0aa3] Submitted process > CAT_FASTQ (L66101_EdenPool_Covid-DD-VIR-00245)
Jan-29 16:04:48.806 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 35; name: CAT_FASTQ (L66100_EdenPool_Covid-DD-VIR-00244); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/0f/a9d31b11a58ba6896acfcfbf2083d8]
Jan-29 16:04:48.811 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.811 [Task submitter] INFO nextflow.Session - [b0/e41d54] Submitted process > CAT_FASTQ (L66087_EdenPool_Covid-DD-VIR-00219)
Jan-29 16:04:48.814 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 13; name: CAT_FASTQ (L66078_EdenPool_Covid-DD-VIR-00207); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/81/4f7d3ab01d35df8434dede990722c9]
Jan-29 16:04:48.820 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.820 [Task submitter] INFO nextflow.Session - [24/b4bee7] Submitted process > CAT_FASTQ (L66085_EdenPool_Covid-DD-VIR-00215)
Jan-29 16:04:48.824 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 25; name: CAT_FASTQ (L66090_EdenPool_Covid-DD-VIR-00226); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/35/b68bc5ca082cac0a2dfeb834217ea3]
Jan-29 16:04:48.828 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.828 [Task submitter] INFO nextflow.Session - [19/8f7b2e] Submitted process > CAT_FASTQ (L66144_EdenPool_cDNA_S41_20201227-787782_01_A06)
Jan-29 16:04:48.832 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 29; name: CAT_FASTQ (L66094_EdenPool_Covid-DD-VIR-00236); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/21/f7ef2cc87ae61f24496d13329203b5]
Jan-29 16:04:48.839 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.839 [Task submitter] INFO nextflow.Session - [97/1600e2] Submitted process > CAT_FASTQ (L66145_EdenPool_cDNA_S42_20201227-787343_01_B06)
Jan-29 16:04:48.906 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 8; name: MAKE_SNPEFF_DB (GCA_009858895.3_ASM985889v3_genomic.200409.fa); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/22/49fc18a973328f28a8ba8c964c0f62]
Jan-29 16:04:48.912 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 22; name: CAT_FASTQ (L66088_EdenPool_Covid-DD-VIR-00221); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/fc/9de7d19fa9899b1018ed7f9c130d08]
Jan-29 16:04:48.913 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.914 [Task submitter] INFO nextflow.Session - [ac/a64d0e] Submitted process > CAT_FASTQ (L66096_EdenPool_Covid-DD-VIR-00238)
Jan-29 16:04:48.921 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.921 [Task submitter] INFO nextflow.Session - [e2/db0d35] Submitted process > CAT_FASTQ (L66102_EdenPool_Covid-DD-VIR-00246)
Jan-29 16:04:48.927 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.927 [Task submitter] INFO nextflow.Session - [98/f973c4] Submitted process > CAT_FASTQ (L66104_EdenPool_cDNA_S1_20210108-799934_01_A01)
Jan-29 16:04:48.969 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 32; name: CAT_FASTQ (L66097_EdenPool_Covid-DD-VIR-00240); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/8c/eb1e125072237010566b835ef69cf8]
Jan-29 16:04:48.975 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:48.975 [Task submitter] INFO nextflow.Session - [3a/4085ea] Submitted process > CAT_FASTQ (L66105_EdenPool_cDNA_S2_20210106-797126_01_B01)
Jan-29 16:04:49.170 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 12; name: CAT_FASTQ (L66077_EdenPool_Covid-DD-VIR-00206); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/15/592959d487540f1fcfc692d9df55e9]
Jan-29 16:04:49.174 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.174 [Task submitter] INFO nextflow.Session - [38/92454e] Submitted process > CAT_FASTQ (L66106_EdenPool_cDNA_S3_20210104-793515_01_C01)
Jan-29 16:04:49.181 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 11; name: CAT_FASTQ (L66076_EdenPool_Covid-DD-VIR-00205); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/96/91d0cf4dde4d86b574f632b32d9d16]
Jan-29 16:04:49.185 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.185 [Task submitter] INFO nextflow.Session - [13/473b1a] Submitted process > CAT_FASTQ (L66107_EdenPool_cDNA_S4_20210110-721656_01_D01)
Jan-29 16:04:49.308 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 14; name: CAT_FASTQ (L66079_EdenPool_Covid-DD-VIR-00208); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/9c/76507b682b4350379f34c3fed7195d]
Jan-29 16:04:49.311 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.311 [Task submitter] INFO nextflow.Session - [c9/699aeb] Submitted process > CAT_FASTQ (L66108_EdenPool_cDNA_S5_20210109-721159_01_E01)
Jan-29 16:04:49.341 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 33; name: CAT_FASTQ (L66098_EdenPool_Covid-DD-VIR-00241); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/9a/86c6865743e7dc7b5f3ea393164f62]
Jan-29 16:04:49.343 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.343 [Task submitter] INFO nextflow.Session - [6c/486b0a] Submitted process > CAT_FASTQ (L66109_EdenPool_cDNA_S6_20210108-720624_01_F01)
Jan-29 16:04:49.349 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 16; name: CAT_FASTQ (L66081_EdenPool_Covid-DD-VIR-00210); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/38/1fbe2088e24fcf2d8d71bcb4216027]
Jan-29 16:04:49.356 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.356 [Task submitter] INFO nextflow.Session - [ee/e1ae84] Submitted process > CAT_FASTQ (L66110_EdenPool_cDNA_S7_20210108-720770_01_G01)
Jan-29 16:04:49.523 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 27; name: CAT_FASTQ (L66092_EdenPool_Covid-DD-VIR-00231); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/e5/7db6cd3ae948f35c8426a4892d9b19]
Jan-29 16:04:49.526 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.526 [Task submitter] INFO nextflow.Session - [6c/67207e] Submitted process > CAT_FASTQ (L66111_EdenPool_cDNA_S8_20210108-720048_01_H01)
Jan-29 16:04:49.530 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 9; name: CAT_FASTQ (L66074_EdenPool_Covid-DD-VIR-00201); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/81/23ed7411e836ceb3f47e131a72f506]
Jan-29 16:04:49.538 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 36; name: CAT_FASTQ (L66101_EdenPool_Covid-DD-VIR-00245); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/a4/5d0aa31e8e2a2a1c41d55d325eb433]
Jan-29 16:04:49.541 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.541 [Task submitter] INFO nextflow.Session - [4f/5893ff] Submitted process > CAT_FASTQ (L66112_EdenPool_cDNA_S9_20210108-720344_01_A02)
Jan-29 16:04:49.545 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.545 [Task submitter] INFO nextflow.Session - [09/68b04a] Submitted process > CAT_FASTQ (L66113_EdenPool_cDNA_S10_20210107-798696_01_B02)
Jan-29 16:04:49.597 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 23; name: CAT_FASTQ (L66087_EdenPool_Covid-DD-VIR-00219); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/b0/e41d544e0ae93b3b1a13948a0fa86c]
Jan-29 16:04:49.600 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.600 [Task submitter] INFO nextflow.Session - [03/d660b8] Submitted process > CAT_FASTQ (L66114_EdenPool_cDNA_S11_20210106-797945_01_C02)
Jan-29 16:04:49.684 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 79; name: CAT_FASTQ (L66145_EdenPool_cDNA_S42_20201227-787343_01_B06); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/97/1600e2676fd9a3bd5bd5c78bf8e2ca]
Jan-29 16:04:49.690 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.691 [Task submitter] INFO nextflow.Session - [41/56446c] Submitted process > CAT_FASTQ (L66115_EdenPool_cDNA_S12_20210106-797963_01_D02)
Jan-29 16:04:49.764 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 19; name: CAT_FASTQ (L66085_EdenPool_Covid-DD-VIR-00215); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/24/b4bee76330bb6c1266aec7a46cb40d]
Jan-29 16:04:49.768 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.769 [Task submitter] INFO nextflow.Session - [fe/7bfe33] Submitted process > CAT_FASTQ (L66116_EdenPool_cDNA_S13_20210108-720393_01_E02)
Jan-29 16:04:49.816 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 78; name: CAT_FASTQ (L66144_EdenPool_cDNA_S41_20201227-787782_01_A06); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/19/8f7b2e585d49d0d23342cc1da5ad71]
Jan-29 16:04:49.820 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.820 [Task submitter] INFO nextflow.Session - [80/b9b465] Submitted process > CAT_FASTQ (L66117_EdenPool_cDNA_S14_20210104-795197_01_F02)
Jan-29 16:04:49.821 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 31; name: CAT_FASTQ (L66096_EdenPool_Covid-DD-VIR-00238); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/ac/a64d0e124058f4106ca369069c6f3d]
Jan-29 16:04:49.828 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.828 [Task submitter] INFO nextflow.Session - [2e/e8da82] Submitted process > CAT_FASTQ (L66118_EdenPool_cDNA_S15_20210104-794211_01_G02)
Jan-29 16:04:49.861 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 37; name: CAT_FASTQ (L66102_EdenPool_Covid-DD-VIR-00246); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/e2/db0d35b8d6a044b4960e78d7ee7d77]
Jan-29 16:04:49.865 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.865 [Task submitter] INFO nextflow.Session - [fa/684ec6] Submitted process > CAT_FASTQ (L66119_EdenPool_cDNA_S16_20210104-794508_01_H02)
Jan-29 16:04:49.976 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 38; name: CAT_FASTQ (L66104_EdenPool_cDNA_S1_20210108-799934_01_A01); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/98/f973c416041bf56ec445e28726a069]
Jan-29 16:04:49.979 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:49.979 [Task submitter] INFO nextflow.Session - [07/869e09] Submitted process > CAT_FASTQ (L66120_EdenPool_cDNA_S17_20210105-796034_01_A03)
Jan-29 16:04:50.076 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 39; name: CAT_FASTQ (L66105_EdenPool_cDNA_S2_20210106-797126_01_B01); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/3a/4085ea0836ae79dfe1c111c2e8d755]
Jan-29 16:04:50.080 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.080 [Task submitter] INFO nextflow.Session - [3f/d866ed] Submitted process > CAT_FASTQ (L66121_EdenPool_cDNA_S18_20210105-796550_01_B03)
Jan-29 16:04:50.120 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 40; name: CAT_FASTQ (L66106_EdenPool_cDNA_S3_20210104-793515_01_C01); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/38/92454ea4b5231b19b684b3921d9c9b]
Jan-29 16:04:50.123 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.123 [Task submitter] INFO nextflow.Session - [6c/d366b6] Submitted process > CAT_FASTQ (L66122_EdenPool_cDNA_S19_20210106-797851_01_C03)
Jan-29 16:04:50.126 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 41; name: CAT_FASTQ (L66107_EdenPool_cDNA_S4_20210110-721656_01_D01); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/13/473b1aed59cb54dc087c438fcb6dfb]
Jan-29 16:04:50.128 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.128 [Task submitter] INFO nextflow.Session - [14/24e7bd] Submitted process > CAT_FASTQ (L66123_EdenPool_cDNA_S20_20210103-793929_01_D03)
Jan-29 16:04:50.164 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 43; name: CAT_FASTQ (L66109_EdenPool_cDNA_S6_20210108-720624_01_F01); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/6c/486b0aff6c030480268baaf8fe9f5f]
Jan-29 16:04:50.166 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.167 [Task submitter] INFO nextflow.Session - [c0/43a774] Submitted process > CAT_FASTQ (L66124_EdenPool_cDNA_S21_20210103-793393_01_E03)
Jan-29 16:04:50.197 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 42; name: CAT_FASTQ (L66108_EdenPool_cDNA_S5_20210109-721159_01_E01); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/c9/699aeb8603c2812b655bd57ff95c49]
Jan-29 16:04:50.200 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.200 [Task submitter] INFO nextflow.Session - [9d/5e0847] Submitted process > CAT_FASTQ (L66125_EdenPool_cDNA_S22_20210103-793390_01_F03)
Jan-29 16:04:50.337 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 44; name: CAT_FASTQ (L66110_EdenPool_cDNA_S7_20210108-720770_01_G01); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/ee/e1ae8489bd48a0e79b3e2843e15c91]
Jan-29 16:04:50.341 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.341 [Task submitter] INFO nextflow.Session - [b1/be8b52] Submitted process > CAT_FASTQ (L66126_EdenPool_cDNA_S23_20210103-793439_01_G03)
Jan-29 16:04:50.452 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 46; name: CAT_FASTQ (L66112_EdenPool_cDNA_S9_20210108-720344_01_A02); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/4f/5893ff34ca2604897a89b20918db9c]
Jan-29 16:04:50.454 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.454 [Task submitter] INFO nextflow.Session - [17/071bea] Submitted process > CAT_FASTQ (L66127_EdenPool_cDNA_S24_20210102-792782_01_H03)
Jan-29 16:04:50.484 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 45; name: CAT_FASTQ (L66111_EdenPool_cDNA_S8_20210108-720048_01_H01); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/6c/67207e44eac9f050eb8e70be1f6054]
Jan-29 16:04:50.487 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.487 [Task submitter] INFO nextflow.Session - [b2/91340c] Submitted process > CAT_FASTQ (L66128_EdenPool_cDNA_S25_20210101-792223_01_A04)
Jan-29 16:04:50.580 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 47; name: CAT_FASTQ (L66113_EdenPool_cDNA_S10_20210107-798696_01_B02); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/09/68b04ae1b388bc18c01a823327eaed]
Jan-29 16:04:50.584 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.585 [Task submitter] INFO nextflow.Session - [76/c8f1e9] Submitted process > CAT_FASTQ (L66129_EdenPool_cDNA_S26_20201230-791215_01_B04)
Jan-29 16:04:50.586 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 48; name: CAT_FASTQ (L66114_EdenPool_cDNA_S11_20210106-797945_01_C02); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/03/d660b80221c6dcbe01ed75b36bf501]
Jan-29 16:04:50.590 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.590 [Task submitter] INFO nextflow.Session - [bb/a4b504] Submitted process > CAT_FASTQ (L66130_EdenPool_cDNA_S27_20201230-790456_01_C04)
Jan-29 16:04:50.608 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 49; name: CAT_FASTQ (L66115_EdenPool_cDNA_S12_20210106-797963_01_D02); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/41/56446c28275b4e533aa15d00c3b587]
Jan-29 16:04:50.611 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.611 [Task submitter] INFO nextflow.Session - [06/777eeb] Submitted process > CAT_FASTQ (L66131_EdenPool_cDNA_S28_20201230-790289_01_D04)
Jan-29 16:04:50.770 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 52; name: CAT_FASTQ (L66118_EdenPool_cDNA_S15_20210104-794211_01_G02); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/2e/e8da822dda73c481c282b570bd1472]
Jan-29 16:04:50.773 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.773 [Task submitter] INFO nextflow.Session - [09/d9e151] Submitted process > CAT_FASTQ (L66132_EdenPool_cDNA_S29_20201230-790328_01_E04)
Jan-29 16:04:50.804 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 50; name: CAT_FASTQ (L66116_EdenPool_cDNA_S13_20210108-720393_01_E02); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/fe/7bfe333ce9dc422811ebb230642f8d]
Jan-29 16:04:50.808 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.808 [Task submitter] INFO nextflow.Session - [34/fb6bae] Submitted process > CAT_FASTQ (L66133_EdenPool_cDNA_S30_20201230-790469_01_F04)
Jan-29 16:04:50.810 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 53; name: CAT_FASTQ (L66119_EdenPool_cDNA_S16_20210104-794508_01_H02); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/fa/684ec6e9967ecdc9c8842ad4d7d37a]
Jan-29 16:04:50.816 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.816 [Task submitter] INFO nextflow.Session - [72/0b7b4a] Submitted process > CAT_FASTQ (L66134_EdenPool_cDNA_S31_20201230-790388_01_G04)
Jan-29 16:04:50.968 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 51; name: CAT_FASTQ (L66117_EdenPool_cDNA_S14_20210104-795197_01_F02); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/80/b9b46584d249056903b64f468881ce]
Jan-29 16:04:50.972 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:50.972 [Task submitter] INFO nextflow.Session - [f4/662279] Submitted process > CAT_FASTQ (L66135_EdenPool_cDNA_S32_20201230-790275_01_H04)
Jan-29 16:04:50.996 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 54; name: CAT_FASTQ (L66120_EdenPool_cDNA_S17_20210105-796034_01_A03); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/07/869e091f43a5b4c0bbba297fe0eb0f]
Jan-29 16:04:51.001 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.001 [Task submitter] INFO nextflow.Session - [a0/7746cd] Submitted process > CAT_FASTQ (L66136_EdenPool_cDNA_S33_20201230-791165_01_A05)
Jan-29 16:04:51.121 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 55; name: CAT_FASTQ (L66121_EdenPool_cDNA_S18_20210105-796550_01_B03); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/3f/d866ed926d80550ae0e50ea5eec4fe]
Jan-29 16:04:51.125 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.125 [Task submitter] INFO nextflow.Session - [d1/43fc04] Submitted process > CAT_FASTQ (L66137_EdenPool_cDNA_S34_20201229-789657_01_B05)
Jan-29 16:04:51.288 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 56; name: CAT_FASTQ (L66122_EdenPool_cDNA_S19_20210106-797851_01_C03); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/6c/d366b6ff4aca91634251e9d5b294cb]
Jan-29 16:04:51.291 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.291 [Task submitter] INFO nextflow.Session - [3c/d49ad1] Submitted process > CAT_FASTQ (L66138_EdenPool_cDNA_S35_20201228-788665_01_C05)
Jan-29 16:04:51.344 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 58; name: CAT_FASTQ (L66124_EdenPool_cDNA_S21_20210103-793393_01_E03); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/c0/43a774ac84a96f18f39f465c19749e]
Jan-29 16:04:51.346 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.346 [Task submitter] INFO nextflow.Session - [e1/b63762] Submitted process > CAT_FASTQ (L66139_EdenPool_cDNA_S36_20201228-788797_01_D05)
Jan-29 16:04:51.388 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 57; name: CAT_FASTQ (L66123_EdenPool_cDNA_S20_20210103-793929_01_D03); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/14/24e7bdb4a1991f4a6bff51aa8edc0c]
Jan-29 16:04:51.390 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.390 [Task submitter] INFO nextflow.Session - [12/424e0e] Submitted process > CAT_FASTQ (L66140_EdenPool_cDNA_S37_20201228-788712_01_E05)
Jan-29 16:04:51.421 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 59; name: CAT_FASTQ (L66125_EdenPool_cDNA_S22_20210103-793390_01_F03); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/9d/5e08477bbf93045cdfa858ee58bed9]
Jan-29 16:04:51.423 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.423 [Task submitter] INFO nextflow.Session - [4a/5590a4] Submitted process > CAT_FASTQ (L66141_EdenPool_cDNA_S38_20201228-788358_01_F05)
Jan-29 16:04:51.500 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 60; name: CAT_FASTQ (L66126_EdenPool_cDNA_S23_20210103-793439_01_G03); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/b1/be8b52e7592f8c89c2f47f97c0b1c6]
Jan-29 16:04:51.505 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.505 [Task submitter] INFO nextflow.Session - [ac/90e40a] Submitted process > CAT_FASTQ (L66142_EdenPool_cDNA_S39_20201228-788063_01_G05)
Jan-29 16:04:51.529 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 63; name: CAT_FASTQ (L66129_EdenPool_cDNA_S26_20201230-791215_01_B04); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/76/c8f1e96eacc74e74a336836b7b5e72]
Jan-29 16:04:51.533 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.533 [Task submitter] INFO nextflow.Session - [4d/c43fd3] Submitted process > CAT_FASTQ (L66143_EdenPool_cDNA_S40_20201228-787781_01_H05)
Jan-29 16:04:51.612 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 61; name: CAT_FASTQ (L66127_EdenPool_cDNA_S24_20210102-792782_01_H03); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/17/071beac07e8ed046765cdfac48ec11]
Jan-29 16:04:51.614 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.614 [Task submitter] INFO nextflow.Session - [79/3c3b41] Submitted process > CAT_FASTQ (L66146_EdenPool_cDNA_S43_20201227-787460_01_C06)
Jan-29 16:04:51.618 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 62; name: CAT_FASTQ (L66128_EdenPool_cDNA_S25_20210101-792223_01_A04); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/b2/91340cba5bc697ecf038adcf64c94f]
Jan-29 16:04:51.625 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.625 [Task submitter] INFO nextflow.Session - [ea/13c5cd] Submitted process > CAT_FASTQ (L66147_EdenPool_cDNA_S44_20201226-787053_01_D06)
Jan-29 16:04:51.712 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 64; name: CAT_FASTQ (L66130_EdenPool_cDNA_S27_20201230-790456_01_C04); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/bb/a4b50431fd7e3b4495b3dc4484ff2d]
Jan-29 16:04:51.715 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.715 [Task submitter] INFO nextflow.Session - [e6/d017db] Submitted process > CAT_FASTQ (L66148_EdenPool_cDNA_S45_20210103-793417_01_E06)
Jan-29 16:04:51.897 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 65; name: CAT_FASTQ (L66131_EdenPool_cDNA_S28_20201230-790289_01_D04); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/06/777eebea303557608d93be7ce982fa]
Jan-29 16:04:51.900 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.900 [Task submitter] INFO nextflow.Session - [9c/1344e9] Submitted process > CAT_FASTQ (L66149_EdenPool_cDNA_S46_20210103-793617_01_F06)
Jan-29 16:04:51.948 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 67; name: CAT_FASTQ (L66133_EdenPool_cDNA_S30_20201230-790469_01_F04); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/34/fb6baec0289e0b3725045a248600a9]
Jan-29 16:04:51.950 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:51.950 [Task submitter] INFO nextflow.Session - [f8/bba5f8] Submitted process > CAT_FASTQ (L66150_EdenPool_cDNA_S47_20210103-793411_01_G06)
Jan-29 16:04:52.061 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 68; name: CAT_FASTQ (L66134_EdenPool_cDNA_S31_20201230-790388_01_G04); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/72/0b7b4a90309edcb1c0194e38a8fcc3]
Jan-29 16:04:52.065 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:52.065 [Task submitter] INFO nextflow.Session - [d4/cd8a88] Submitted process > CAT_FASTQ (L66151_EdenPool_cDNA_S48_20210103-792272_01_H06)
Jan-29 16:04:52.068 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 69; name: CAT_FASTQ (L66135_EdenPool_cDNA_S32_20201230-790275_01_H04); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/f4/662279be13bc1ef173978f609794e5]
Jan-29 16:04:52.073 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:52.073 [Task submitter] INFO nextflow.Session - [cf/1f2fc8] Submitted process > CAT_FASTQ (L66152_EdenPool_Covid-DD-VIR-00103)
Jan-29 16:04:52.089 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 4; name: get_software_versions; status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/99/ab7350c18e31255310114459b124bb]
Jan-29 16:04:52.093 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 66; name: CAT_FASTQ (L66132_EdenPool_cDNA_S29_20201230-790328_01_E04); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/09/d9e15114e1459fa14a46ef7fc7eaed]
Jan-29 16:04:52.093 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:52.093 [Task submitter] INFO nextflow.Session - [33/aa3b31] Submitted process > CAT_FASTQ (L66153_EdenPool_FH_0152)
Jan-29 16:04:52.098 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 70; name: CAT_FASTQ (L66136_EdenPool_cDNA_S33_20201230-791165_01_A05); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/a0/7746cda21070cfeb6fed4e05353473]
Jan-29 16:04:52.098 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:52.098 [Task submitter] INFO nextflow.Session - [9f/d91a4c] Submitted process > CAT_FASTQ (L66154_EdenPool_FH_0170)
Jan-29 16:04:52.105 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:52.105 [Task submitter] INFO nextflow.Session - [d7/2d078d] Submitted process > CAT_FASTQ (L66155_EdenPool_FH_0455)
Jan-29 16:04:52.253 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 72; name: CAT_FASTQ (L66138_EdenPool_cDNA_S35_20201228-788665_01_C05); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/3c/d49ad142687482d29992645cb56a0e]
Jan-29 16:04:52.257 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:52.257 [Task submitter] INFO nextflow.Session - [8e/5a9863] Submitted process > CAT_FASTQ (L66156_EdenPool_FH_0769)
Jan-29 16:04:52.337 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 71; name: CAT_FASTQ (L66137_EdenPool_cDNA_S34_20201229-789657_01_B05); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/d1/43fc04b80fe00fcfe25cc33dd805b8]
Jan-29 16:04:52.340 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:52.341 [Task submitter] INFO nextflow.Session - [75/ac8598] Submitted process > CAT_FASTQ (L66157_EdenPool_FH_0770)
Jan-29 16:04:52.488 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 73; name: CAT_FASTQ (L66139_EdenPool_cDNA_S36_20201228-788797_01_D05); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/e1/b63762e4f4dc53e2f9f43ef97424a4]
Jan-29 16:04:52.493 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:52.494 [Task submitter] INFO nextflow.Session - [50/474db9] Submitted process > CAT_FASTQ (L66158_EdenPool_FH_0790)
Jan-29 16:04:52.620 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 75; name: CAT_FASTQ (L66141_EdenPool_cDNA_S38_20201228-788358_01_F05); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/4a/5590a4395b3018a9c04538ca18c2f9]
Jan-29 16:04:52.625 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:52.626 [Task submitter] INFO nextflow.Session - [79/851e6d] Submitted process > CAT_FASTQ (L66159_EdenPool_Covid-DD-VIR-00247)
Jan-29 16:04:52.626 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 76; name: CAT_FASTQ (L66142_EdenPool_cDNA_S39_20201228-788063_01_G05); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/ac/90e40a1f35178f1e802356616f0917]
Jan-29 16:04:52.721 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 74; name: CAT_FASTQ (L66140_EdenPool_cDNA_S37_20201228-788712_01_E05); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/12/424e0effc8a49be5aac16864a66e3d]
Jan-29 16:04:52.769 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 77; name: CAT_FASTQ (L66143_EdenPool_cDNA_S40_20201228-787781_01_H05); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/4d/c43fd32e0f2f749fd4b01ce15aa6f2]
Jan-29 16:04:52.773 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 80; name: CAT_FASTQ (L66146_EdenPool_cDNA_S43_20201227-787460_01_C06); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/79/3c3b4148c68c5dde4a2b9b2d33502f]
Jan-29 16:04:52.845 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 81; name: CAT_FASTQ (L66147_EdenPool_cDNA_S44_20201226-787053_01_D06); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/ea/13c5cdd02ca360651d5b6de72820e4]
Jan-29 16:04:52.933 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 82; name: CAT_FASTQ (L66148_EdenPool_cDNA_S45_20210103-793417_01_E06); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/e6/d017db51f9a720c6dfc800cbc75314]
Jan-29 16:04:52.936 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:52.936 [Task submitter] INFO nextflow.Session - [9b/70cee0] Submitted process > FASTQC (L66086_EdenPool_Covid-DD-VIR-00218)
Jan-29 16:04:52.969 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 83; name: CAT_FASTQ (L66149_EdenPool_cDNA_S46_20210103-793617_01_F06); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/9c/1344e9d6f0cacc0131caa9fcf9e04b]
Jan-29 16:04:53.037 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 84; name: CAT_FASTQ (L66150_EdenPool_cDNA_S47_20210103-793411_01_G06); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/f8/bba5f80219b0f124fd0122b89660e9]
Jan-29 16:04:53.060 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 85; name: CAT_FASTQ (L66151_EdenPool_cDNA_S48_20210103-792272_01_H06); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/d4/cd8a88a697a1c1d567219162f70be1]
Jan-29 16:04:53.260 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 86; name: CAT_FASTQ (L66152_EdenPool_Covid-DD-VIR-00103); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/cf/1f2fc85c66414ce28c5eb878f6a2a8]
Jan-29 16:04:53.266 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 87; name: CAT_FASTQ (L66153_EdenPool_FH_0152); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/33/aa3b319dc3166a54fe83826aee3754]
Jan-29 16:04:53.364 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 88; name: CAT_FASTQ (L66154_EdenPool_FH_0170); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/9f/d91a4c3783006c6da9fd2b64ba8c03]
Jan-29 16:04:53.366 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:53.366 [Task submitter] INFO nextflow.Session - [b9/9c83de] Submitted process > FASTP (L66086_EdenPool_Covid-DD-VIR-00218)
Jan-29 16:04:53.448 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 89; name: CAT_FASTQ (L66155_EdenPool_FH_0455); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/d7/2d078d47553332a8028a32e528991e]
Jan-29 16:04:53.455 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 90; name: CAT_FASTQ (L66156_EdenPool_FH_0769); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/8e/5a9863bccaac2d59b67050f59999bb]
Jan-29 16:04:53.493 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 91; name: CAT_FASTQ (L66157_EdenPool_FH_0770); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/75/ac8598497ef7801737fb468b48ff7a]
Jan-29 16:04:53.609 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 92; name: CAT_FASTQ (L66158_EdenPool_FH_0790); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/50/474db92fd3d9b409f02d0aea6b4597]
Jan-29 16:04:53.676 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 93; name: CAT_FASTQ (L66159_EdenPool_Covid-DD-VIR-00247); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/79/851e6dbd68d3e21b855c0de399c578]
Jan-29 16:04:58.277 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 95; name: FASTQC (L66086_EdenPool_Covid-DD-VIR-00218); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/9b/70cee026491c6b3868f42bf7b63f48]
Jan-29 16:04:58.285 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:04:58.285 [Task submitter] INFO nextflow.Session - [72/7c6b51] Submitted process > FASTQC (L66099_EdenPool_Covid-DD-VIR-00243)
Jan-29 16:05:03.201 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 96; name: FASTQC (L66099_EdenPool_Covid-DD-VIR-00243); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/72/7c6b518ac1f5250300a57eadb16d34]
Jan-29 16:05:03.205 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:03.206 [Task submitter] INFO nextflow.Session - [41/32b6eb] Submitted process > FASTP (L66099_EdenPool_Covid-DD-VIR-00243)
Jan-29 16:05:05.552 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 94; name: FASTP (L66086_EdenPool_Covid-DD-VIR-00218); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/b9/9c83defbd8e71dbf0802bfcb1f8246]
Jan-29 16:05:05.557 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:05.557 [Task submitter] INFO nextflow.Session - [c9/b3b26f] Submitted process > FASTQC (L66080_EdenPool_Covid-DD-VIR-00209)
Jan-29 16:05:10.393 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 98; name: FASTQC (L66080_EdenPool_Covid-DD-VIR-00209); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/c9/b3b26faee1218913255be20f92783a]
Jan-29 16:05:10.397 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:10.397 [Task submitter] INFO nextflow.Session - [b0/3bd9ff] Submitted process > FASTP (L66080_EdenPool_Covid-DD-VIR-00209)
Jan-29 16:05:11.357 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 97; name: FASTP (L66099_EdenPool_Covid-DD-VIR-00243); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/41/32b6ebc91a6e9c44e1d2a6227b5294]
Jan-29 16:05:11.361 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:11.361 [Task submitter] INFO nextflow.Session - [77/15a96a] Submitted process > FASTQC (L66089_EdenPool_Covid-DD-VIR-00225)
Jan-29 16:05:16.309 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 100; name: FASTQC (L66089_EdenPool_Covid-DD-VIR-00225); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/77/15a96a627858e29aa57ed4d737a670]
Jan-29 16:05:16.314 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:16.314 [Task submitter] INFO nextflow.Session - [b9/73eb29] Submitted process > FASTP (L66089_EdenPool_Covid-DD-VIR-00225)
Jan-29 16:05:18.521 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 99; name: FASTP (L66080_EdenPool_Covid-DD-VIR-00209); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/b0/3bd9ffa974be35acb098e64e735915]
Jan-29 16:05:18.526 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:18.526 [Task submitter] INFO nextflow.Session - [14/139f49] Submitted process > FASTP (L66075_EdenPool_Covid-DD-VIR-00203)
Jan-29 16:05:25.597 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 103; name: FASTP (L66075_EdenPool_Covid-DD-VIR-00203); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/14/139f49a415a39389f105874bdd6ccd]
Jan-29 16:05:25.601 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:25.602 [Task submitter] INFO nextflow.Session - [15/c9f701] Submitted process > FASTQC (L66075_EdenPool_Covid-DD-VIR-00203)
Jan-29 16:05:26.601 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 101; name: FASTP (L66089_EdenPool_Covid-DD-VIR-00225); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/b9/73eb295f19bd2702d3cba1138d4053]
Jan-29 16:05:26.605 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:26.605 [Task submitter] INFO nextflow.Session - [c1/94a425] Submitted process > FASTQC (L66084_EdenPool_Covid-DD-VIR-00213)
Jan-29 16:05:31.545 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 102; name: FASTQC (L66075_EdenPool_Covid-DD-VIR-00203); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/15/c9f701f860de8cb4bccaa5f620202e]
Jan-29 16:05:31.549 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:31.549 [Task submitter] INFO nextflow.Session - [3f/9b4d47] Submitted process > FASTP (L66084_EdenPool_Covid-DD-VIR-00213)
Jan-29 16:05:31.589 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 104; name: FASTQC (L66084_EdenPool_Covid-DD-VIR-00213); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/c1/94a4258145cd345cc8545de512e5d5]
Jan-29 16:05:31.593 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:31.593 [Task submitter] INFO nextflow.Session - [e4/f1464d] Submitted process > FASTQC (L66083_EdenPool_Covid-DD-VIR-00212)
Jan-29 16:05:35.513 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 106; name: FASTQC (L66083_EdenPool_Covid-DD-VIR-00212); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/e4/f1464d64eeba0abeb39754b6dcb871]
Jan-29 16:05:35.518 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:35.518 [Task submitter] INFO nextflow.Session - [db/dfa667] Submitted process > FASTP (L66083_EdenPool_Covid-DD-VIR-00212)
Jan-29 16:05:39.618 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 105; name: FASTP (L66084_EdenPool_Covid-DD-VIR-00213); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/3f/9b4d477164f19c68dfde1fdba02f4f]
Jan-29 16:05:39.622 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:39.622 [Task submitter] INFO nextflow.Session - [7d/08c5e8] Submitted process > FASTP (L66093_EdenPool_Covid-DD-VIR-00235)
Jan-29 16:05:45.580 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 107; name: FASTP (L66083_EdenPool_Covid-DD-VIR-00212); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/db/dfa667a5de08f25b485aed706c4341]
Jan-29 16:05:45.585 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:45.585 [Task submitter] INFO nextflow.Session - [69/7a513e] Submitted process > FASTQC (L66093_EdenPool_Covid-DD-VIR-00235)
Jan-29 16:05:47.617 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 109; name: FASTP (L66093_EdenPool_Covid-DD-VIR-00235); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/7d/08c5e824285d6f441e629421060421]
Jan-29 16:05:47.621 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Jan-29 16:05:47.622 [Task submitter] INFO nextflow.Session - [43/666074] Submitted process > FASTQC (L66091_EdenPool_Covid-DD-VIR-00229)
Jan-29 16:05:50.605 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 108; name: FASTQC (L66093_EdenPool_Covid-DD-VIR-00235); status: COMPLETED; exit: 0; error: -; workDir: /home/crtd_bioinf/fabirost/projects/illudev/bfx1527/nfcore/work/69/7a513e68614cd5c9f90dc7ef873bfa]
Some packages are not available in MacOsX version
bioconda::sra-tools=2.10.3 the version available for MacOsX is bioconda::sra-tools=2.10.1
wkhtmltopdf=0.12.4 is not available on MacOsX neither
I dont know if it can be "downgraded" or trigger a WARN/INFO notification asking to use Docker/Singularity
** Conda version: 4.8.2 **
I have checked the following places for your error:
While running viralrecon using data from the SNAP/Swift protocol, the pipeline repeatedly crashed at the ASCIIGenome step:
If I skip the ASCIIGenome step (--skip_asciigenome
), the pipeline finishes as expected. I was asked to create this issue by @drpatelh (https://nfcore.slack.com/archives/C0110R22NH3/p1623156803141900?thread_ts=1623119196.129800&cid=C0110R22NH3)
Steps to reproduce the behaviour:
nextflow run nf-core/viralrecon --platform illumina --input samplesheet.csv --genome 'NC_045512.2' --protocol amplicon --primer_bed swift.bed --primer_left_suffix '_F' --primer_right_suffix '_R' --ivar_trim_offset 5 --skip_assembly -profile singularity --max_memory "50.0 GB"
Error executing process > 'NFCORE_VIRALRECON:ILLUMINA:VARIANTS_IVAR:ASCIIGENOME (sample1)'
Caused by:
Process `NFCORE_VIRALRECON:ILLUMINA:VARIANTS_IVAR:ASCIIGENOME (sample1)` terminated with an error exit status (1)
Command executed:
zcat sample1.vcf.gz \
| grep -v '#' \
| awk -v FS=' ' -v OFS=' ' '{print $1, ($2-50-1), ($2+50)}' \
> variants.bed
ASCIIGenome \
-ni \
-x "trackHeight 0 bam#1 && trackHeight 50 bam@2 && readsAsPairs -on && filterVariantReads && save sample1.%r.pdf" \
--batchFile variants.bed \
--fasta GCF_009858895.2_ASM985889v3_genomic.200409.fna \
sample1.ivar_trim.sorted.bam \
sample1.vcf.gz \
swift.bed \
GCF_009858895.2_ASM985889v3_genomic.200409.gff \
> /dev/null
echo $(ASCIIGenome -ni --version 2>&1) | sed -e "s/ASCIIGenome //g" > asciigenome.version.txt
Command exit status:
1
Command output:
(empty)
Command error:
WARNING: Skipping mount /usr/local/var/singularity/mnt/session/etc/resolv.conf [files]: /etc/resolv.conf doesn't exist in container
Cannot read history file '/home/default/.asciigenome.yaml'
Indexing 'GCF_009858895.2_ASM985889v3_genomic.200409.fna'.
Initializing coordinates... Done from: sample1.ivar_trim.sorted.bam
Cannot read history file '/home/default/.asciigenome.yaml'
Invalid coordinates: -36 64
Exception in thread "main" exceptions.InvalidGenomicCoordsException
at tracks.IntervalFeature.validateIntervalFeature(IntervalFeature.java:231)
at tracks.IntervalFeature.intervalFeatureFromBedLine(IntervalFeature.java:183)
at tracks.IntervalFeature.<init>(IntervalFeature.java:70)
at samTextViewer.Main.main(Main.java:150)
ASCIIGenome to generate the correct output files, and for the pipeline to complete without error.
Have you provided the following extra information/files:
.nextflow.log
filenextflow run
commandWhat's the best way to privately share some reads that might allow the issue to be replicated?
Came across these improvements for ivar in the IDseq github:
chanzuckerberg/idseq-workflows@d922823
When processing swift libraries polymerases can add additional bases causing issues with trimming. I guess this happens for swift libraries only?
We will need to decide on a flexible input format for the pipeline. I implemented something similar for the nf-core/covid19 pipeline, however this pipeline will only cater for Illumina data at the moment:
sample,fastq_1,fastq_2
SRR10903401,SRR10903401_S1_L003_R1_001.fastq.gz,SRR10903401_S1_L003_R2_001.fastq.gz
SRR10948474,SRR10948474_S1_L002_R1_001.fastq.gz,SRR10948474_S1_L002_R2_001.fastq.gz
SRR10948474,SRR10948474_S1_L005_R1_001.fastq.gz,SRR10948474_S1_L005_R2_001.fastq.gz
SRR10903402,SRR10903402_S1_L002_R1_001.fastq.gz,
SRR10903402,SRR10903402_S1_L005_R1_001.fastq.gz,
SRR10948550,,
A final design file may look something like the one above. SRR10903401
was only sequenced once in Illumina PE format, SRR10948474
was sequenced twice in Illumina PE format, SRR10903402
was sequenced twice in Illumina SE format and SRR10948550
is an SRA id we can use to obtain the data using either the fromSRA
function in NF or via SRA Explorer.
This caters for the same sample being sequenced on multiple lanes/runs and it allows for the auto-detection of Illumina data in order to process paired-end and single-end data together. We could also extend the samplesheet format to cater for other options in the future.
hi,
reading from https://nf-co.re/viralrecon/1.0.0/output#ivar-variants-and-ivar-consensus
it seems you suggests ivar can output in vcf format top of tsv:
variants/ivar/
.tsv: Low frequency variants in TSV format.
.vcf.gz: Low frequency variants VCF file.
.vcf.gz.tbi: Low frequency variants VCF index file.
I cannot read anywhere how to run ivar to call variants outputs in vcf. any suggestions?
thanks!
ibseq
Hi guys!
We will be sequencing several hundred virus strains, and I am looking for a pipeline to do de-novo assembly and variant calling.
Since I have been working with nfcore @drpatelh in the past, I would like to try out this pipeline. The error message, I am currently getting is:
Error executing process > 'MINIA (L50982_v1_S1_ampfree)'
Caused by:
Process `MINIA (L50982_v1_S1_ampfree)` terminated with an error exit status (1)
Command executed:
echo "L50982_v1_S1_ampfree.viral_1.fastq.gz
L50982_v1_S1_ampfree.viral_2.fastq.gz" > input_files.txt
minia \
-kmer-size 31 \
-abundance-min 20 \
-nb-cores 6 \
-in input_files.txt \
-out L50982_v1_S1_ampfree.k31.a20
mv L50982_v1_S1_ampfree.k31.a20.contigs.fa L50982_v1_S1_ampfree.k31.scaffolds.fa
Command exit status:
1
and further down in the .command.log:
EXCEPTION: error opening file: L50982_v1_S1_ampfree.k31.a20.contigs.fa (No such file or directory)
The way I run the pipeline, is:
nextflow run nf-core/viralrecon --input $base/samplesheet.S1S2.csv --protocol 'amplicon' --amplicon_bed $ampliconBed --amplicon_fasta $ampliconFasta --genome 'MN908947.3' --igenomes_ignore --kraken2_db $kraken2Db --outdir $base -with-singularity $base/viralrecon_dev.sif -c dcgc.config -r dev
Would you be able to help me out?
Best wishes
Katrin
Don't think this pattern is a good idea, if it works it's a bug!
Lines 55 to 72 in a85d596
Would be good to cite all of the software used in the pipeline in a separate file like here:
https://github.com/nf-core/atacseq/blob/master/CITATIONS.md
Some of the tool citations can be pinched directly from there.
Hi,
There seems to be some conflicts with the version of R and some packages, maybe only the package scales
. The entire pipeline ran smoothly with the test data, but on my own data this error arose:
Mar-15 14:07:32.450 [Task monitor] ERROR nextflow.processor.TaskProcessor - Error executing process > 'MOSDEPT
H_AMPLICON_PLOT'
Caused by:
Process `MOSDEPTH_AMPLICON_PLOT` terminated with an error exit status (1)
Command executed:
plot_mosdepth_regions.r \
--input_files SWIFT25213950.trim.mkD.amplicon.regions.bed.gz \
--input_suffix .trim.mkD.amplicon.regions.bed.gz \
--output_dir ./ \
--output_suffix .trim.mkD.amplicon.regions
Command exit status:
1
Command output:
(empty)
Command error:
package ‘scales’ was built under R version 3.6.3
Loading required package: grid
========================================
ComplexHeatmap version 2.2.0
Bioconductor page: http://bioconductor.org/packages/ComplexHeatmap/
Github page: https://github.com/jokergoo/ComplexHeatmap
Documentation: http://jokergoo.github.io/ComplexHeatmap-reference
If you use it in published research, please cite:
Gu, Z. Complex heatmaps reveal patterns and correlations in multidimensional
genomic data. Bioinformatics 2016.
========================================
Loading required package: viridisLite
Loading required package: viridisLite
Attaching package: ‘viridis’
The following object is masked from ‘package:scales’:
viridis_pal
Warning messages:
1: package ‘viridis’ was built under R version 3.6.3
2: package ‘viridisLite’ was built under R version 3.6.3
── Attaching packages ─────────────────────────────────────── tidyverse 1.3.0 ──
✔ tibble 3.0.1 ✔ dplyr 1.0.0
✔ tidyr 1.1.0 ✔ stringr 1.4.0
✔ readr 1.3.1 ✔ forcats 0.5.0
✔ purrr 0.3.4
── Conflicts ────────────────────────────────────────── tidyverse_conflicts() ──
✖ readr::col_factor() masks scales::col_factor()
✖ purrr::discard() masks scales::discard()
✖ dplyr::filter() masks stats::filter()
✖ dplyr::lag() masks stats::lag()
Warning messages:
1: package ‘tidyverse’ was built under R version 3.6.3
2: package ‘tibble’ was built under R version 3.6.3
3: package ‘tidyr’ was built under R version 3.6.3
4: package ‘readr’ was built under R version 3.6.3
5: package ‘purrr’ was built under R version 3.6.3
6: package ‘dplyr’ was built under R version 3.6.3
7: package ‘stringr’ was built under R version 3.6.3
8: package ‘forcats’ was built under R version 3.6.3
Error: Dimensions exceed 50 inches (height and width are specified in 'cm' not pixels).
If you're sure you want a plot that big, use `limitsize = FALSE`.
Backtrace:
█
1. └─ggplot2::ggsave(...)
2. └─ggplot2:::plot_dim(...)
Execution halted
Related to #5 to perform end-to-end test of the pipeline on GitHub Actions CI, we need to create a kraken2
small host DBs and upload it to nf-core/test-datasets. The suggested idea is to generate the DB using human chr22
.
Hi,
it seems that the mosdepth
coverage is encoded as a 16-bit unsigned integer, at least for the amplicon coverage calculation.
This leads to amplicons with coverage > 65 535 being cut-off at this value.
Not sure if it is coming from mosdepth
or the R script.
When running the dev nf-core/viralrecon v1.2.0dev (224865c), I noticed the multiQC report does not have information for Kraken2 % non-host reads even though the kraken2 reports are generated correctly. There are NAs instead of actual percentages. Also the coverage information is not displayed in the variant calling metrics section.
Thanks
Ryan
Would be good to do this to see how consistently we are calling the same variants and possibly as a way to prioritise which variants to look at. Should be quite straightforward to do this with the command:
bcftools isec --nfiles +2 <VCF_FILES>
Where --nfiles +2
indicates that the variant must be called by at least 2 callers to be included in the output file. We will have to be careful how we pick that number because that will change if the number of callers is changed with the --callers
parameter.
We will need to obtain a full-sized dataset to test the pipeline from end-to-end. We can just add a test_full.config
like I have done here for the atacseq
pipeline:
https://github.com/nf-core/atacseq/blob/dev/conf/test_full.config
This means we can also use the same config for the automated AWS tests that will be carried out before the pipeline is released.
At the moment we have separate processes that run SPAdes
and MetaSPAdes
, however, given that the latter can just be invoked by using the standard spades.py
command with the addition of --meta
it would be nicer if instead we have a single process for SPAdes
and let the user decide which program to use e.g. --spades_assembler metaspades
. We would have to validate these options internally to make sure the correct assembler is provided. Also, this would tie in quite nicely with the option to choose for example the specialist coronaSPAdes assembler where appropriate.
We will have to be careful with this though because the inputs and outputs may change dependng on the assembler that is used. Would need to run them all to test things are working as expected and that we are staging the correct files.
We could also have a --spades_hmm
parameter to provide custom HMM models specific to the virus being investigated.
When I run on AWS EC2, spades via unicycler throws an error about $TERM
, seems a silly thing to fail on
...
Error executing process > 'UNICYCLER (SRR11241255_T2)'
Caused by:
Process `UNICYCLER (SRR11241255_T2)` terminated with an error exit status (1)
Command executed:
unicycler \
--threads 2 \
-s SRR11241255_T2.viral.fastq.gz \
--out ./
mv assembly.fasta SRR11241255_T2.assembly.fasta
Command exit status:
1
Command output:
Command: /opt/conda/envs/nf-core-viralrecon-1.0dev/bin/unicycler --threads 2 -s SRR11241255_T2.viral.fastq.gz --out ./
Unicycler version: v0.4.7
Using 2 threads
The output directory already exists and files may be reused or overwritten:
/home/ec2-user/viralrecon/work/09/88015a408ee1b4b01fa8e1aa42df79
Dependencies:
Program Version Status
spades.py 3.14.0 good
racon not used
makeblastdb 2.9.0+ good
tblastn 2.9.0+ good
bowtie2-build 2.3.5.1 good
bowtie2 2.3.5.1 good
samtools 1.9 good
java 11.0.1-internal good
pilon 1.23 good
bcftools not used
SPAdes read error correction (2020-04-03 19:52:23)
Unicycler uses the SPAdes read error correction module to reduce the number
of errors in the short read before SPAdes assembly. This can make the assembly
faster and simplify the assembly graph structure.
Command: /opt/conda/envs/nf-core-viralrecon-1.0dev/bin/spades.py -s SRR11241255_T2.viral.fastq.gz -o spades_assembly/read_correction --threads 2 --only-error-correction
Corrected reads:
spades_assembly/corrected_u.fastq.gz
Choosing k-mer range for assembly (2020-04-03 19:52:28)
Unicycler chooses a k-mer range for SPAdes based on the length of the input
reads. It uses a wide range of many k-mer sizes to maximise the chance of
finding an ideal assembly.
SPAdes maximum k-mer: 127
Median read length: 108
K-mer range: 21, 37, 51, 61, 71, 79, 87, 93, 99, 103
SPAdes assemblies (2020-04-03 19:52:28)
Unicycler now uses SPAdes to assemble the short reads. It scores the
assembly graph for each k-mer using the number of contigs (fewer is better) and
the number of dead ends (fewer is better). The score function is 1/(c*(d+2)),
where c is the contig count and d is the dead end count.
Command error:
tput: No value for $TERM and no -T specified
tput: No value for $TERM and no -T specified
tput: No value for $TERM and no -T specified
Error: SPAdes failed to produce assemblies. See spades_assembly/assembly/spades.log for more info.
[ec2-user@ip-... viralrecon]$ env | grep TERM
TERM=xterm-256color
Add pipeline summary to README.md
. See https://github.com/nf-core/atacseq#pipeline-summary
Hi There,
First of all, a big thank you to everyone developing and maintaining Viralrecon; it has become integral to our laboratory's SARS-CoV-2 response.
We were excited to see in the latest version that you have included both the Nextclade and Pangolin typing tools. Would it be possible to generate a basic report (e.g., a .tsv file) comprising the sample name, clade and lineage calls? I admit, I am being lazy here, but it might be a nice report to have generated when a user is processing a large number of samples. For example:
Sample | Nextclade | Pangolin |
---|---|---|
Frodo | 20A | B.1.617.2 |
Sam | 20A | B.1.617.2 |
Thanks again for all your hard work on Viralrecon, and for considering this request.
All the best,
Cody
The setup is a cluser of machines with docker and nextflow installed. Each machine runs a nextflow node
process and a docker daemon.
I am trying to run your workflow on the cluster by executing the following command on one node.
nextflow run nf-core/viralrecon -profile test,docker -process.executor ignite
The cluster starts to process the test pipeline, but get stuck in the following error.
Caused by:
java.nio.file.NoSuchFileException: /work/3f/4b5b5e80605434963098c246e097b7/.command.run
Command executed:
bowtie2-build \
--seed 1 \
--threads 2 \
GCF_009858895.2_ASM985889v3_genomic.200409.fna \
GCF_009858895.2_ASM985889v3_genomic.200409
mkdir Bowtie2Index && mv GCF_009858895.2_ASM985889v3_genomic.200409* Bowtie2Index
Command exit status:
-
Command output:
(empty)
Work dir:
/work/3f/4b5b5e80605434963098c246e097b7
Tip: when you have fixed the problem you can continue the execution adding the option `-resume` to the run command line
-[nf-core/viralrecon] Pipeline completed with errors-
Each node of the cluster seems to do some work until the error appears.
Running the viralrecon pipeline (version 1.1.0) using docker. The kit used to make the libraries is the swift v2 (additional coverage) panel. When trying to generate the mosdepth amplicon plots ggplot2 throws an error:
Error: Dimensions exceed 50 inches (height and width are specified in 'cm' not pixels). If you're sure you want a plot that big, use
limitsize = FALSE`.
Backtrace:
█
@drpatelh directed me to the correct area to modify:
viralrecon/bin/plot_mosdepth_regions.r
Line 109 in 75a2f97
ggsave(file=outfile, plot, height=3+(0.3*length(unique(sample_dat$region))), width=16, units="cm")
ggsave(file=outfile, plot, height=3+(0.3*length(unique(sample_dat$region))), width=16, units="cm",limitsize = FALSE)
adding limitsize = FALSE
like the error suggested allowed the pipeline to complete. However, it generates a huge plot
all_samples.trim.amplicon.regions.heatmap.pdf
This amplicon panel has 345 primers vs the ~200 primers for ARTIC v3. For ARTIC the plot breaks down the the genome in 98 amplicons as the primers have clear names. For the Swift primers the naming convention of the primers might be throwing off the "grouping" of amplicons.
For metagenomic samples, exclude unmapped reads from final output BAM file.
We will need to properly document/explain all of the outputs generated by the pipeline along with some nice plots and figures:
https://github.com/nf-core/atacseq/blob/dev/docs/output.md
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.