Comments (6)
@ahrimj21 Sorry about this error.
Can you run with the --debug
flag and paste the output here?
from crispresso2.
Traceback (most recent call last):
File "/opt/anaconda3/envs/crispresso2_env/lib/python3.8/site-packages/CRISPResso2/CRISPRessoCORE.py", line 3210, in main
mod_pcts.append(np.concatenate((['Insertions'], np.array(all_insertion_count_vectors[ref_name]).astype(np.float)/tot)))
File "/opt/anaconda3/envs/crispresso2_env/lib/python3.8/site-packages/numpy/init.py", line 305, in getattr
raise AttributeError(former_attrs[attr])
AttributeError: module 'numpy' has no attribute 'float'.
np.float
was a deprecated alias for the builtin float
. To avoid this error in existing code, use float
by itself. Doing this will not modify any behavior and is safe. If you specifically wanted the numpy scalar type, use np.float64
here.
The aliases was originally deprecated in NumPy 1.20; for more details and guidance see the original release note at:
https://numpy.org/devdocs/release/1.20.0-notes.html#deprecations
CRITICAL @ Fri, 21 Jun 2024 21:47:01:
Traceback (most recent call last):
File "/opt/anaconda3/envs/crispresso2_env/lib/python3.8/site-packages/CRISPResso2/CRISPRessoCORE.py", line 3210, in main
mod_pcts.append(np.concatenate((['Insertions'], np.array(all_insertion_count_vectors[ref_name]).astype(np.float)/tot)))
File "/opt/anaconda3/envs/crispresso2_env/lib/python3.8/site-packages/numpy/init.py", line 305, in getattr
raise AttributeError(former_attrs[attr])
AttributeError: module 'numpy' has no attribute 'float'.
np.float
was a deprecated alias for the builtin float
. To avoid this error in existing code, use float
by itself. Doing this will not modify any behavior and is safe. If you specifically wanted the numpy scalar type, use np.float64
here.
The aliases was originally deprecated in NumPy 1.20; for more details and guidance see the original release note at:
https://numpy.org/devdocs/release/1.20.0-notes.html#deprecations
CRITICAL @ Fri, 21 Jun 2024 21:47:01:
Unexpected error, please check your input.
ERROR: module 'numpy' has no attribute 'float'.
np.float
was a deprecated alias for the builtin float
. To avoid this error in existing code, use float
by itself. Doing this will not modify any behavior and is safe. If you specifically wanted the numpy scalar type, use np.float64
here.
The aliases was originally deprecated in NumPy 1.20; for more details and guidance see the original release note at:
https://numpy.org/devdocs/release/1.20.0-notes.html#deprecations
WARNING:root:CRISPResso command failed (return value 255) on batch #4: "CRISPResso -o /Users/ahrim/CRISPRessoBatch_on_2024-05-17_crispressobatch_input-Red --name A05 --trimmomatic_command trimmomatic --amplicon_name 11 --needleman_wunsch_aln_matrix_loc EDNAFULL --coding_seq AGTACCCAAAGGCAAGTGGAACAGCTCTAATGGGGTTGAAGAAAAGGAGACTTGGGTGGAAGAGGATGAACTGTTTCAAGTTCAGG --needleman_wunsch_gap_incentive 1 --debug --max_paired_end_reads_overlap 100 --min_bp_quality_or_N 0 --amplicon_seq GCGAACCTCGATTGTGGTCACAACGGGACAGGAAGGAGTACAGGGCCAAGAGTGAGCCAAGACCAGAATCTGGGACAATCCAGGGTGAATTTGTTTTATACCTGTGCTCTCCTTGATCTCCCCTCAGAGTACCCAAAGGCAAGTGGAACAGCTCTAATGGGGTTGAAGAAAAGGAGACTTGGGTGGAAGAGGATGAACTGTTTCAAGTTCAGGGTAAGCAGAAGATTCTCCTTGGCCTCTTCTTGATGCTTGCTGAAGTACAGATGCGTG --flexiguide_homology 80 --fastq_r2 /Users/ahrim/Desktop/Summer_Lab/Ahrim_SummerWork/Data/fastqs/Red/DH20240417RedV4A05_S321_L001_R2_001.fastq.gz --plot_window_size 20 --flash_command flash --conversion_nuc_to T --max_rows_alleles_around_cut_to_plot 50 --min_paired_end_reads_overlap 10 --quantification_window_size 15 --prime_editing_pegRNA_extension_quantification_window_size 5 --exclude_bp_from_left 15 --min_frequency_alleles_around_cut_to_plot 0.2 --needleman_wunsch_gap_extend -2 --exclude_bp_from_right 15 --needleman_wunsch_gap_open -20 --n_processes 1 --guide_seq GGTTGAAGAAAAGGAGACTT --aln_seed_min 2 --fastq_r1 /Users/ahrim/Desktop/Summer_Lab/Ahrim_SummerWork/Data/fastqs/Red/DH20240417RedV4A05_S321_L001_R1_001.fastq.gz --prime_editing_pegRNA_scaffold_min_match_length 1 --conversion_nuc_from C --aln_seed_count 5 --min_average_read_quality 0 --aln_seed_len 10 --min_single_bp_quality 0 --quantification_window_center "-3" --default_min_aln_score 60"
from crispresso2.
Sorry that you are running into this error, would you mind sharing the version of numpy
you have installed? I think this may be due to having version 2.0.0 of numpy
installed. We will fix this in the next release, but in the meantime everything should work if you install version 1.26.4 of numpy
. Let us know if this works or not!
from crispresso2.
I have numpy version 1.24.3 installed.
from crispresso2.
Thanks, do you know what version of CRISPResso you have installed? It looks like the latest version (v2.3.1) has this bug fixed https://github.com/pinellolab/CRISPResso2/blob/master/CRISPResso2/CRISPRessoCORE.py#L3764
Please let us know if you still see this error on v2.3.1!
from crispresso2.
I have CRISPResso version 2.2.8! I will try installing the latest version right now and let you know. Thank you
from crispresso2.
Related Issues (20)
- Alleles frequency table plot not generated HOT 3
- INDELs not recognized in the allele frequency table HOT 2
- CRIPSResso2 package not included in channel HOT 1
- How to solve Error 0? HOT 4
- Allele plot doesn't show base letter HOT 2
- Confused about sequence directions in prime editing parameters HOT 6
- ERROR: Offset around cut would be greater than reference sequence length. HOT 2
- CRISPRessoAgregate
- ERROR: NUMPY RELATED HOT 1
- A small mistake in 'CRISPResso_quantification_of_editing_frequency.txt' HOT 1
- Error message: alignment amplicon sequence to reads HOT 3
- Question about CRISPResso for WGS - and potential feature HOT 1
- High % of "AMBIGUOUS" reads – what are they? HOT 3
- ERROR:HDR number in the plot not the same as the number in txt file HOT 2
- @N-yating If you pin to Python 2.7, it will install an old version of CRISPResso2. I would recommend using Python 3 for the most recent version of CRISPResso2.
- CRISPResso2 breaks because on lack of pin in matplotlib version HOT 3
- http://crispresso2.pinellolab.org/ - 502 Bad gateway HOT 2
- CRISPRessoAggregate failure HOT 2
- amplicon for Targeted Sequencing
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from crispresso2.