Creating a file by default as it does now makes it harder to construct pipelines

Hello Evan. Thank you for creating this software, it has been really helpful. I'm having an issue with the map2gaf command and I don't know why. The gaf file is empty, and the log while i created is:

Use of uninitialized value $go_mappings[4] in split at /usr/local/share/perl/5.26.1/HMMER2GO/Command/map2gaf.pm line 93, <$in> line 38952. (this log repeats through all of the numbers

The command line I input is:
hmmer2go map2gaf -i genes_orfs_Pfam-A_GO_GOterm_mapping.tsv -o genes_orfs_Pfam-A_GO_GOterm_mapping.gaf -s 'Cirriformia mooreii'

I have the go file and the Pfam2go file in my workspace since I'm doing this locally because For some reason I can't download files from the internet.

Thank you for any help you could give me
Esteban Velásquez Agudelo

...this applies specifically to the getorf and run commands.

Hi,

Several months ago we discussed a new conda install. Is that still in the works?

Hello,

I am trying to install hmmer2go as a module on a cluster. So far, I have installed all the dependencies:

perl Makefile.PL
Checking if your kit is complete...
Looks good
Generating a Unix-style Makefile
Writing Makefile for HMMER2GO
Writing MYMETA.yml and MYMETA.json

and also made sure that EMBOSS and HMMER 3 are in my path.
I keep encountering the following problems during the make test step:

make test
PERL_DL_NONLAZY=1 "/data/cm/shared/apps/ActivePerl/5.22/bin/perl-static" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(0, 'blib/lib', 'blib/arch')" t/*.t
t/00-load.t ........ 1/3 # Testing HMMER2GO 0.17, Perl 5.022001, /data/cm/shared/apps/ActivePerl/5.22/bin/perl-static
t/00-load.t ........ ok
t/01-fetchmap.t .... ok
t/02-getorf.t ...... ok
t/03-run.t ......... ok
t/04-mapterms.t .... 3/9
#   Failed test 'Correct number of GO terms mapped'
#   at t/04-mapterms.t line 63.
#          got: '3'
#     expected: '2'
t/04-mapterms.t .... 8/9 # Looks like you failed 1 test of 9.
t/04-mapterms.t .... Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/9 subtests
t/05-map2gaf.t ..... ok
t/06-pfamsearch.t .. 2/10
#   Failed test 'Found the correct number of HMMs for the search term'
#   at t/06-pfamsearch.t line 39.
#          got: '7'
#     expected: '13'
t/06-pfamsearch.t .. 6/10 # Looks like you failed 1 test of 10.
t/06-pfamsearch.t .. Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/10 subtests
t/07-customdb.t .... ok

Test Summary Report
-------------------
t/04-mapterms.t  (Wstat: 256 Tests: 9 Failed: 1)
  Failed test:  6
  Non-zero exit status: 1
t/06-pfamsearch.t (Wstat: 256 Tests: 10 Failed: 1)
  Failed test:  2
  Non-zero exit status: 1
Files=8, Tests=54, 36 wallclock secs ( 0.08 usr  0.01 sys + 12.09 cusr  2.55 csys = 14.73 CPU)
Result: FAIL
Failed 2/8 test programs. 2/54 subtests failed.
make: *** [test_dynamic] Error 255

Any thoughts on what could be the culprit here?

Best,
MD

Hey - I'm getting these errors when running make test:

PERL_DL_NONLAZY=1 "/usr/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef Test::Harness::Switches; test_harness(0, 'blib/lib', 'blib/arch')" t/.t
t/00-load.t ........ 1/3 # Testing HMMER2GO 0.17.2, Perl 5.022001, /usr/bin/perl
t/00-load.t ........ ok
t/01-fetchmap.t .... ok
t/02-getorf.t ...... ok
t/03-run.t ......... ok
t/04-mapterms.t .... ok
t/05-map2gaf.t ..... ok
t/06-pfamsearch.t .. 1/10 Use of uninitialized value $dbnum in concatenation (.) or string at /home/beetle/Downloads/hmmer2go/HMMER2GO-0.17.2/blib/lib/HMMER2GO/Command/pfamsearch.pm line 94.
t/06-pfamsearch.t .. 2/10

Failed test 'Found the correct number of HMMs for the search term'

at t/06-pfamsearch.t line 39.

got: undef

expected: '7'

Failed test 'Found the HMMs in the correct number of databases'

at t/06-pfamsearch.t line 40.

got: undef

expected: '4'

Failed test 'Wrote the correct number of descriptions to the output file'

at t/06-pfamsearch.t line 51.

got: undef

expected: '10'

Use of uninitialized value $dbnum in concatenation (.) or string at /home/beetle/Downloads/hmmer2go/HMMER2GO-0.17.2/blib/lib/HMMER2GO/Command/pfamsearch.pm line 89.
t/06-pfamsearch.t .. 6/10

Failed test 'Fetched the correct number of HMMs for the search term'

at t/06-pfamsearch.t line 61.

got: undef

expected: '10'

Use of uninitialized value $hmmnum in addition (+) at t/06-pfamsearch.t line 64.

Looks like you planned 10 tests but ran 7.

Looks like you failed 4 tests of 7 run.

Looks like your test exited with 255 just after 7.

t/06-pfamsearch.t .. Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 7/10 subtests
t/07-customdb.t .... ok

Test Summary Report

t/06-pfamsearch.t (Wstat: 65280 Tests: 7 Failed: 4)
Failed tests: 2-3, 5, 7
Non-zero exit status: 255
Parse errors: Bad plan. You planned 10 tests but ran 7.
Files=8, Tests=51, 36 wallclock secs ( 0.06 usr 0.01 sys + 13.57 cusr 2.41 csys = 16.05 CPU)
Result: FAIL
Failed 1/8 test programs. 4/51 subtests failed.
Makefile:891: recipe for target 'test_dynamic' failed
make: *** [test_dynamic] Error 255

Thanks,

Currently, the output consists of TSV files with mappings of genes or transcripts to GO terms.

It would be helpful to take a GFF3 file as input and add GO terms to the file for viewing with genome browsers.

I am struggling to understand the -nm option. The manual says:
-nm, --nomet
Do not report only those ORFs starting with Methionine (Default: Yes).

So if I want to report only those ORFs that start with a methionine I should choose No. I have tried various permutations e.g. '-nm No and -nm False' but the output is the same as if I had run the default. I also don't get an error to tell me either is incorrect.

How do I turn this option 'off'?

This may be more of a clarification than an issue - I'm starting off with 21175 predicted genes from Maker, but I end up with only 6993 of the predicted genes having GO terms mapped to them by the end, in the GOterm_mapping.tsv file. Hopefully I'm just missing something obvious, this is what I am running, let me know if info from intermediate steps would be helpful...

hmmer2go getorf -i ~/Documents/Arthropod_Genomes/genome_files/agla_transcripts.fa -o AGLA_genes_orfs.faa

hmmer2go run --cpu 20 -i AGLA_genes_orfs.faa -d Pfam-A.hmm -o AGLA_genes_orf_Pfam-A.tblout

hmmer2go mapterms -i AGLA_genes_orfs_Pfam-A.tblout -o AGLA_genes_orfs_Pfam-A_GO.tsv --map

Thanks!

Hi Evan,

I have some issues with the newest version of hmmer2go (HMMER2GO-0.17.7)

I've just run a test run on a small fasta file containing a unitig (short nuclear sequence used in building of contigs during the genome assembly).

hmmer2go getorf -i AIRE_splitted_UTG_reads_ab_clean.fasta -o hmmer2go_test_AIRE_ab_fasta --verbose -n 8 

It throws the following error, although it produces an output file with a detected ORF.

========== Searching for ORFs with minimum length of 80.
Can't use string ("1") as a SCALAR ref while "strict refs" in use at /home/lorke/perl5/lib/perl5/HMMER2GO/Command/getorf.pm line 112.

This is the content of the input file:

>utg7180000171672
CTTCCCAGTATAGGAACTGATGAGGCTTCAGAACAAGTGGGTGCCCACTCTAGCCAAGGT
GTAGTGAAAACCCCATCCCCTACGTGCAGGCTCCCTGGTGAGCAGGCAGTGTAGCTTGGG
GTAGCTCTCCATGTTGTAGTCCTTGGTAAGACTGCTCCAGAAGGCCCGGAGGATGGGTCG
ACCCTGAAGCAGGACCCAGGACACCAGGGAGTACATGGCCCTGTGCACCCCGGCCTTCCC
CTGGCTCACCATCGTGTCCTGAGAGACGTAGACAGCAGAGAGCTCTCCTCAAGCGTCGTT
TTCATGATGATGCATTCAACAGTGGTACAAATATTTAATTATTTTGTCAAGTATTTAGAG
TGTTGCCCGTGGATTGATAGATGGATATTTTATTCATCCCCTTGGGGAACTCAGGTTTCC
AGTAGCTCACAAAGGTAGTCGACAGATGGTAACGAAATGGACAACCGGTAAAAGTCAATC
AAAAAAGTAAATAAAAGTGAGCAATATTGCACACAATTGAAATTGCATTTAAAAAACAGC
CAGTGGTAGACATAAATAAATAAATATTACGCAATTCCACACTGTCCAGTGTGTGTGGGG
GCTGGGTTGAGGGAGAGAGAGACAGAAAGAGTCATGATGGGCCACTACCCTTGCCTGAGT
TGTTGTGTAGTCTGATGGCTGTGGGGACAAAGGTTGTTCTGTACTGTACAGGTACAGAAC
ATGAAGATGTACACAACCTATTATTGCTTGTATAATATCCCATCAAACAATGACCTTCAC
AAGAGCACACTGGCAACTAAACGTAAACACAGGTGCTTATGATATCAATCCTTGACTGAC
ATAGTTTCAAATTGGATTCGTTTTACTATTAAGGTCAAATGATGATCTGATTATAGCATG
TCAAATAAATGAAAATATTGTATTGCAACCAAAAGGTTGTAGCATGACCGTCGACGCTAC
GTTAGCCTCTTCTGGTCGGTGTTGTGTGATGGATGAGCTCCTATCCTCTTACCTTGAGCA
GCTGGTCAGTGATGATGTTTCTATCAGCCAGGCCGTGCACCAGGGGGAAGGGGTCGTCTA
CGGCCATGGCGATGTCGGTGCGCAGCTCTCTCAGCCGAGTGCGAAGGTCGGTGGTCCCAT
AAATCTCAACCCTGGACATGTTACTCTAACTCTGTGTGTAGATATCTGAGTCCCCGTAAA
TCTGAAGCATGAACATGTTACCCTGAGTCTTTTTTCGGTGTATGCAGGTCTGTTGGTGCA
TCCATACACTAAGCCTGATGGACGTTTAGTGTTGTGTGGACAAGAAGAACGGGGATCCTG
GTTTTGATGAGTTGGACGTGTCCACCCTTTTACACCCTGAACGTGTGAGGGAGTAACAGG
GAGGTTTGAGATGTGTCAATGTTGCCTGTGAGGAGGTGTGTCTTTTTATAAAAGGAAGGT
GGTGTTTTAGAGAAAAGAGTCAAATATCTGAAATAGTTTGCATCCATCTAGTCGAGTCTT
TGGAATTGCATGCGATCAAGTGTTATAAATGCGCACACAAAGACATACACACACACACAC
ACCCATACACACAGACACAATTCCCTTAACATTTCAGGCTATTAAAACATCGATAGGAAT
AAAAAGTAATATTTT

I've installed the older version of hmmer2go (HMMER2GO-0.17.2)
and run the same test:

hmmer2go getorf -i AIRE_splitted_UTG_reads_ab_clean.fasta -o hmmer2go_older_version_AIRE_ab_fasta --verbose -n 8

========== Searching for ORFs with minimum length of 80.

========== 1 and 1 sequences in AIRE_splitted_UTG_reads_ab_clean.fasta.

========== 1 sequences processed with ORFs above 80.

========== 1.00 percent of sequences contain ORFs above 80.

and it went without any issues. I've checked both output files with diff and they're identical.

I've repeated the test run on additional fasta files with the older version of hmmer2go and it also went smoothly.
It seems to me that the bug might have been introduced in the latest version.

All the best,

Lorena

The syntax:

my $termct = (split /\,/, $terms);

throws a warning in 5.10.1.

Hey Evan,

I'm thinking about annotating some transcriptomes using hmmer2go instead of mapping uniprot IDs. I prefer using transdecoder for all my translation needs. Mind if I fork the code and test some things out, letting a user defer to transdecoder peptides rather than using getorf?

Thanks,
Alex

Hi,

I do not have docker. Will hmmer2go be available as a conda download soon? This would really help improve adoption by a large number of researchers.

M

Hello,

Thank you for your tools, it is very useful.
I would like to ask, how the tool defines the significance of hits? Is it possible to set custom e-value threshold?

Thanks

The location of the mapping files have changed on the new GO website. These are no longer under the FTP repo. Updating this would also fix #10.

Hello @sestaton ,

Thank you for developing and maintaining this tool.

During the test run, I got error messages regarding missing Bio::DB::Taxonomy module. This was due to the absence of BioPerl from my install. I think this module should be checked as prerequisite perl module in Makefile.PL.

This line in the tutorial doesn't work:
hmmer2go pfam2go -t mads,mads-box -o mads_mads-box_pfamsearch.out -d

I'm assuming it should be changed to pfamsearch.

The research of an external program in the PATH variable returns the last occurrence of the program instead of the first occurrence. Please correct this, it is not the right behaviour.

We should run similary- and model-based searches. Currently, only model-bases searches are used. The run command is easy to extend, this issue is a reminder to add this option.

Hi,

I have followed the tutorial and think I have the correct outputs. Allow the tutorial showed that the *tblout file should be used, which is not created by 'hmmer2go run'. I used *_scan. When I run Ontologizer I get a message that says:

Skipping association of item "NECHADRAFT_88713_8" to GO:0050662 because term is obsolete!
(Are the obo file and the association file in sync?)

I may be interpreting this incorrectly, but I assume this is because there is a discrepancy between the latest obo fle and the one used by 'hmmer2go fetchmap -o pfam2go'. Is it possible to use an updated file for fetchmap, or do I need to use an old obo file?

Also, the output of getorf create gene names are followed by '_N'. So when creating files for -s and -p does it matter that those gene names do not have the suffixes?

I hope that makes sense. Thank you.

Hi, excuse me my english it is no my native language

I have a file with 61 sequences in FASTA format but hmmer2go only return 30 ORF's, I received this comment:

"Can't use string ("61") as a SCALAR ref while "strict refs" in use at /usr/local/share/perl/5.22.1/HMMER2GO/Command/getorf.pm line 124"

How to fix it

Thanks for your help

Hello,
First, I have to thank you for your project. I successfully run the tutorial steps on a genome sequence downloaded from NCBI and now looking at the results. For curiosity, I tried the Demonstration script, and there are two changes to make:

The Arabidopsis_thaliana.TAIR10.22.cdna.all.fa.gz was renamed to Arabidopsis_thaliana.TAIR10.cdna.all.fa.gz, and the ftp link to http://ftp.gramene.org/release-60/fasta/arabidopsis_thaliana/cdna/

Just that.

Thank you for your time,
best regards

Hi, I tried to use the hmmer2go run in the command line and it reported the following error:

Error: File existence/permissions problem in trying to open HMM file b.
HMM file b not found (nor an .h3m binary of it); also looked in PFAMDB

How should I fix that? Thx in advance!

Hi, I am having a problem when "make test" the program. It can't fetch files from the ftp.

Below is the detail log about the issue, I changed the code to DEBUG => 1 in the perl module where defining the $ftp connection.

Please advise, thanks!

$ hmmer2go fetchmap -o pfam2go
Net::FTP>>> Net::FTP(3.09)
Net::FTP>>>   Exporter(5.72)
Net::FTP>>>   Net::Cmd(3.09)
Net::FTP>>>   IO::Socket::SSL(2.033)
Net::FTP>>>     IO::Socket::IP(0.37)
Net::FTP>>>       IO::Socket(1.38)
Net::FTP>>>         IO::Handle(1.35)
Net::FTP=GLOB(0x186ba5c8)<<< 220 (vsFTPd 2.2.2)
Net::FTP=GLOB(0x186ba5c8)>>> USER anonymous
Net::FTP=GLOB(0x186ba5c8)<<< 331 Please specify the password.
Net::FTP=GLOB(0x186ba5c8)>>> PASS ....
Net::FTP=GLOB(0x186ba5c8)<<< 230 Login successful.
Net::FTP=GLOB(0x186ba5c8)>>> CWD /pub/go/external2go
Net::FTP=GLOB(0x186ba5c8)<<< 250 Directory successfully changed.
Net::FTP=GLOB(0x186ba5c8)>>> FEAT
Net::FTP=GLOB(0x186ba5c8)<<< 211-Features:
Net::FTP=GLOB(0x186ba5c8)<<<  EPRT
Net::FTP=GLOB(0x186ba5c8)<<<  EPSV
Net::FTP=GLOB(0x186ba5c8)<<<  MDTM
Net::FTP=GLOB(0x186ba5c8)<<<  PASV
Net::FTP=GLOB(0x186ba5c8)<<<  REST STREAM
Net::FTP=GLOB(0x186ba5c8)<<<  SIZE
Net::FTP=GLOB(0x186ba5c8)<<<  TVFS
Net::FTP=GLOB(0x186ba5c8)<<<  UTF8
Net::FTP=GLOB(0x186ba5c8)<<< 211 End
Net::FTP=GLOB(0x186ba5c8)>>> SIZE pfam2go
Net::FTP=GLOB(0x186ba5c8)<<< 213 715160
Net::FTP=GLOB(0x186ba5c8)>>> PASV
Net::FTP=GLOB(0x186ba5c8)<<< 227 Entering Passive Mode (171,67,205,83,47,133).
Net::FTP=GLOB(0x186ba5c8)>>> RETR pfam2go
Net::FTP=GLOB(0x186ba5c8)<<< 425 Failed to establish connection.
get failed Failed to establish connection.
 will retry. at /home/bma/perl5/lib/perl5/HMMER2GO/Command/fetchmap.pm line 80.
Use of uninitialized value $lsize in numeric eq (==) at /home/bma/perl5/lib/perl5/HMMER2GO/Command/fetchmap.pm line 83.
Use of uninitialized value $lsize in concatenation (.) or string at /home/bma/perl5/lib/perl5/HMMER2GO/Command/fetchmap.pm line 83.
Failed to fetch complete file: pfam2go (local size: , remote size: 715160), will retry. at /home/bma/perl5/lib/perl5/HMMER2GO/Command/fetchmap.pm line 83.
Use of uninitialized value $lsize in numeric eq (==) at /home/bma/perl5/lib/perl5/HMMER2GO/Command/fetchmap.pm line 86.

Hi Evan,
I wanna use Hmmer2go - it's great tool for my purpose, but after run this simple command ...

$ hmmer2go getorf -i Data/nk_seq -o prot_seq_trans -l 90

I get an error message ...

ERROR: Identifiers such as 'Locus_1_Transcript_1/1_Confidence_1.000_Length_826' will produce unexpected renaming with EMBOSS. Exiting. at /usr/local/share/perl/5.18.2/HMMER2GO/Command/getorf.pm line 161, <$fh> chunk 2.

I am not familiar with Emboss, so i am not sure, what is wrong with my seq identifiers.

Thank you for your time and reply

Jirka

Include BLAST2GO, Trinotate...others? Add suggestions here.

Importantly, I need to select a common set of analyses to perform to be fair.

It really, hard for me to install in my linux server, it ask for a lot of dependencies, help.

Dear Evan Staton,
Hello! Thank you a lot for benefiting the community by writing the wonderful HMMER2GO package for Gene Ontology mapping. However, I found difficulties connecting to ftp.geneontology,org during my installation of HMMER2GO 0.18.0 in the Linux Ubuntu system. I first tried to use the git command to install HMMER2GO, but the installation failed to show
Cannot connect to ftp.geneontology.org: Connection refused will retry. at /root/HMMER2GO-0.18.0/blib/lib/HMMER2GO/Command/mapterms.pm line 162..
Alternatively, I tried to install it by downloading the source code followed by make, make test and make install. However, during the make test, a similar issue occurred by showing that

root@DESKTOP-1G86O4Q:~/HMMER2GO-0.18.0# make test
PERL_DL_NONLAZY=1 "/usr/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(0, 'blib/lib', 'blib/arch')" t/*.t
t/00-load.t ........ 1/3 # Testing HMMER2GO 0.18.0, Perl 5.030000, /usr/bin/perl
t/00-load.t ........ ok
t/01-fetchmap.t .... ok
t/02-getorf.t ...... ok
t/03-run.t ......... ok
t/04-mapterms.t .... 1/9 Cannot connect to ftp.geneontology.org: Connection refused will retry. at /root/HMMER2GO-0.18.0/blib/lib/HMMER2GO/Command/mapterms.pm line 162.
Cannot connect to ftp.geneontology.org: Connection refused will retry. at /root/HMMER2GO-0.18.0/blib/lib/HMMER2GO/Command/mapterms.pm line 162.
Cannot connect to ftp.geneontology.org: Connection refused will retry. at /root/HMMER2GO-0.18.0/blib/lib/HMMER2GO/Command/mapterms.pm line 162.
Cannot connect to ftp.geneontology.org: Connection refused will retry. at /root/HMMER2GO-0.18.0/blib/lib/HMMER2GO/Command/mapterms.pm line 162.

[ERROR]: Failed to get mapping file after multiple attempts: Can't call method "login" on an undefined value at /root/HMMER2GO-0.18.0/blib/lib/HMMER2GO/Command/mapterms.pm line 165.
 at /usr/local/share/perl/5.30.0/App/Cmd.pm line 473.
"blib/bin/hmmer2go mapterms -i t/test_data/t_orfs_long_Pfam-A.tblout -o t/test_data/t_long_Pfam-A_mapped_goterms.tsv -p t/test_data/pfam2go" unexpectedly returned exit value 111 at t/04-mapterms.t line 29.
# Looks like your test exited with 111 just after 1.
t/04-mapterms.t .... Dubious, test returned 111 (wstat 28416, 0x6f00)
Failed 8/9 subtests
t/05-map2gaf.t ..... ok
t/06-pfamsearch.t .. 2/10
#   Failed test 'Found the correct number of HMMs for the search term'
#   at t/06-pfamsearch.t line 39.
#          got: '103'
#     expected: '16'

It seems that the connection to ftp.geneontology.org was unsuccessful, but other commands (for example, getting ORF) seem to be working well. I was wondering how I could solve this problem. I tried to connect to ftp.geneontology.org through my windows browser but it also failed. I was wondering whether it would be a problem with the website. Thank you for taking the time to read this email, and hope to hear from you soon.
Best Regards,
Xiao Wang

Hi,
I am seeing following error after running make test command

PERL_DL_NONLAZY=1 "/usr/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(0, 'blib/lib', 'blib/arch')" t/*.t
t/00-load.t ........ 1/3 # Testing HMMER2GO 0.18.3, Perl 5.030000, /usr/bin/perl
t/00-load.t ........ ok
t/01-fetchmap.t .... ok
t/02-getorf.t ...... ok
t/03-run.t ......... ok
t/04-mapterms.t .... ok
t/05-map2gaf.t ..... ok
t/06-pfamsearch.t .. 2/10
# Failed test 'Found the correct number of HMMs for the search term
# at t/06-pfamsearch.t line 40.
# got: undef
# expected: '103'

# Failed test 'Found the HMMs in the correct number of databases'
# at t/06-pfamsearch.t line 41.
# got: undef
# expected: '4'

# Failed test 'Output file of descriptions produced
# at t/06-pfamsearch.t line 43.
Can't open 't/hmmer2go_test_termsearch.out' for reading: 'No such file or directory' at t/06-pfamsearch.t line 46
# Looks like your test exited with 255 just after 4.
t/06-pfamsearch.t .. Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 9/10 subtests
t/07-customdb.t .... 2/5
# Failed test 'Expected HMM database created
# at t/07-customdb.t line 30.

# Failed test 'Expected raw output of HMMscan from hmmer2go search
# at t/07-customdb.t line 35.

# Failed test 'Expected domain table output of HMMscan from hmmer2go search
# at t/07-customdb.t line 36.

# Failed test 'Expected hit table output of HMMscan from hmmer2go search
# at t/07-customdb.t line 37.
# Looks like you failed 4 tests of 5.
t/07-customdb.t .... Dubious, test returned 4 (wstat 1024, 0x400)
Failed 4/5 subtests

Test Summary Report
-------------------
t/06-pfamsearch.t (Wstat: 65280 Tests: 4 Failed: 3)
Failed tests: 2-4
Non-zero exit status: 255
Parse errors: Bad plan. You planned 10 tests but ran 4.
t/07-customdb.t (Wstat: 1024 Tests: 5 Failed: 4)
Failed tests: 2-5
Non-zero exit status: 4
Files=8, Tests=54, 30 wallclock secs ( 0.04 usr 0.02 sys + 10.75 cusr 5.54 csys = 16.35 CPU)
Result: FAIL
Failed 2/8 test programs. 7/54 subtests failed.
make: *** [Makefile:900: test_dynamic] Error 4

can someone please explain how to resolve this issue?

Thanks
Amol

The current behavior is to report multiple ORFs if they are all of the max length, instead of just randomly picking one to report. This seems like the safest behavior but the program should warn when this happens to minimize confusion with the results.