Giter VIP home page Giter VIP logo

dna-fountain's Introduction

Encoding example

Create a compressed tar archive:

tar -b1 -czvf info_to_code.tar.gz ./info_to_code/

Zero-padding to make the input a multiple of 512bytes

truncate -s2116608 ./info_to_code.tar.gz

Or download the original archive:

wget http://files.teamerlich.org/dna_fountain/dna-fountain-input-files.tar.gz

Actual encoding of data as DNA (output is a FASTA file):

python encode.py \
--file_in info_to_code.tar.gz \
--size 32 \
-m 3 \
--gc 0.05 \
--rs 2 \
--delta 0.001 \
--c_dist 0.025 \
--out info_to_code.tar.gz.dna \
--stop 72000

Add annealing sites:

cat info_to_code.tar.gz.dna | grep -v '>' |\
awk '{print "GTTCAGAGTTCTACAGTCCGACGATC"$0"TGGAATTCTCGGGTGCCAAGG"}' \
> info_to_code.tar.gz.dna_order

Output file is ready to order synthetic DNA.

Decoding example

Convert BCL to FASTQ using picard (https://github.com/broadinstitute/picard):

for i in {1101..1119} {2101..2119}; do
mkdir ~/Downloads/fountaincode/seq_data3/$i/;
done

for i in {1101..1119} {2101..2119}; do
java -jar ~/Downloads/picard-tools-2.5.0/picard.jar \
IlluminaBasecallsToFastq \
BASECALLS_DIR=./raw/19854859/Data/Intensities/BaseCalls/ \
LANE=1 \
OUTPUT_PREFIX=./seq_data3/$i/ \
RUN_BARCODE=19854859 \
MACHINE_NAME=M00911 \
READ_STRUCTURE=151T6M151T \
FIRST_TILE=$i \
TILE_LIMIT=1 \
FLOWCELL_BARCODE=AR4JF;
done

(Sequencing data are available at www.ebi.ac.uk/ena/data/view/PRJEB19305 and www.ebi.ac.uk/ena/data/view/PRJEB19307)

Read stitching using PEAR (Zhang J et al., Bioinformatics, 2014). This step takes the 150nt reads and places them together to get back the full oligo.

for i in {1101..1119} {2101..2119}; do
pear -f ./$i.1.fastq -r ./$i.2.fastq -o $i.all.fastq;
done

Retain only fragments with 152nt (the original oligo size):

awk '(NR%4==2 && length($0)==152){print $0}' *.all.fastq.assembled.fastq > all.fastq.good

Sort to prioritize highly abundant reads:

sort -S4G all.fastq.good | uniq -c > all.fastq.good.sorted
gsed -r 's/^\s+//' all.fastq.good.sorted |\
sort -r -n -k1 -S4G > all.fastq.good.sorted.quantity

Exclude column 1 specifying the number of times a read was seen and exclude reads with N:

cut -f2 -d' ' all.fastq.good.sorted.quantity |\
grep -v 'N' > all.fastq.good.sorted.seq
# Decoding:
python ~/Downloads/fountaincode/receiver.py \
-f ./seq_data3/all.fastq.good.sorted.seq \
--header_size 4 \
--rs 2 \
--delta 0.001 \
--c_dist 0.025 \
-n 67088 \
-m 3 \
--gc 0.05 \
--max_hamming 0 \
--out decoder.out.bin

checksum verification:

md5 decoder.out.bin

expected output is 8651e90d3a013178b816b63fdbb94b9b

md5 info_to_code.tar.gz

expected output is 8651e90d3a013178b816b63fdbb94b9b

dna-fountain's People

Contributors

agordon avatar dinovski avatar ubiquitousgenomics avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

dna-fountain's Issues

Is bitwise addition used?

In the publication for DNA Fountain, bitwise addition was used for mixing the strings to make DNA of the right content (GC content, homopolymer), but I don't really see bitwise addition here (and would you even be able to decode that?), what did you do instead to produce DNA of the right content?

Best,
Big fan, amazing work.

Minor bug in the decoder.

Hello,

I believe I have found a minor bug that causes the decoder to reject more oligos than necessary. When screening the oligo for homopolymers and GC content in the add_dna method from glass.pyx, the droplet in question does not contain its rs code. This might cause the oligo's GC content to shift outside of the designated range and cause its rejection.

I hope this helps,
Munsu

Website unreachable

Hi,
I find that the link dnafountain.teamerlich.org is unreachable currently. Is it possible to download your example data with any other ways?

python 3 issues.

Hello,
First of all thanks for this great project. I was trying it out and I have the following configuration:

  • Python 3.6.0 |Anaconda 4.3.0 (x86_64)| (default, Dec 23 2016, 13:19:00)

After compilation and building, I can not run encode.py. The following error occurs:

python dna-fountain/encode.py --file_in info_to_code.tar.gz --size 32 -m 3 --gc 0.05 --rs 2 --delta 0.001 --c_dist 0.025 --out info_to_code.tar.gz.dna --stop 72000
Traceback (most recent call last):
  File "dna-fountain/encode.py", line 9, in <module>
    from fountain import DNAFountain
  File "fountain.pyx", line 5, in init fountain (fountain.c:3663)
    from droplet import Droplet
  File "droplet.pyx", line 5, in init droplet (droplet.c:2294)
    from utils import int_to_four, four_to_dna
  File "utils.pyx", line 5, in init utils (utils.c:10448)
    from string import maketrans   # Required to call maketrans function.
ImportError: cannot import name maketrans

It looks like maketrans and python 3 are not going along well together (http://stackoverflow.com/questions/27539884/maketrans-not-working-for-petl-with-python3-4/27540139)

Could you propose any workarounds?

Thanks
Edi

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.