Comments (3)
Hi @Niwradel! Thanks for the positive feedback! I am not sure if I understand your question completely. Right now orfipy doesn't report overlapping/nested ORFs in the same frame. I don't understand "maximize the density of longest ORFs along scaffolds"
Can you please provide an example? I am interested in knowing.
from orfipy.
Hello, here is an example :
ORF1 |--------|
ORF2 |----|
ORF3 |---------|
ORF4 |--------|
In that example, I wanted to know if orfipy authorize overlapping ORFs (with threshold) as in ORF1 and ORF2? or do it takes only the longest (ORF1?).
And as in ORF3 and ORF4 the overlapping is too high, so you keep the longest (ORF3?)
from orfipy.
Thanks for the example. If ORF1 and ORF2 are in different frames then both ORFs are reported (given they match you min and max length parameter).
If ORF1 and ORF2 are in the same frame then first start and first stop is reported as ORF regardless of the length. Below example ORF2 is longer but since its START is in-frame inside another ORF it is not considered as a START.
e.g. assuming same frame,
ORF1 |----------|
ORF2 |-----------------------------------------------------|
ORF 1 has leftmost (towards 5') START and STOP so ORF1 is reported.
NOTE ORF2 may still be reported by orfipy if you set the --partial-5
flag. First codon in ORF2 will be the one right after the STOP in ORF1. partial-5 means ORFs without a start codon but a stop codon. Similarly there is a flag --partial-3
Here is a small example:
>s1
ATGGGGGGGTTTAAATAGTTTCCCGTTCCCTTTAAATTTGCCATTGGTGCCTTTAAATGGCGTTTTAAACGTTAG
orfipy --min 0 --outdir out s.fa | grep frame=1
Processed 1 sequences in 0.21 seconds
s1 0 15 ID=s1_ORF.1;ORF_type=complete;ORF_len=15;ORF_frame=1;Start:ATG;Stop:TAG 0 +
With --partial-5"
orfipy --min 0 --outdir out --partial-5 s.fa | grep frame=1
Processed 1 sequences in 0.21 seconds
s1 0 15 ID=s1_ORF.1;ORF_type=complete;ORF_len=15;ORF_frame=1;Start:ATG;Stop:TAG 0 +
s1 18 72 ID=s1_ORF.2;ORF_type=5-prime-partial;ORF_len=54;ORF_frame=1;Start:NA;Stop:TAG 0 +
from orfipy.
Related Issues (16)
- Log commands HOT 1
- Is there a tool to update gtf/gff file according to orfipy results? HOT 1
- Description dictionary
- ImportError: undefined symbol: PySlice_Adjustindices HOT 1
- Suggestion: deterministic ORF IDs
- Run Multiple Codon Table Numbers HOT 1
- OverflowError: cannot serialize a string larger than 4GiB HOT 3
- Output intermediate ORFs
- Python 3.9 support using conda HOT 3
- conda installation issue HOT 4
- cannot install from bioconda HOT 5
- Compatibility with lower-case fasta sequences (A weird bug) HOT 7
- Raises IndexError if no match along the specified strand is found HOT 1
- Not all ORFs found? HOT 3
- Full length ORF HOT 1
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from orfipy.