atks / vt Goto Github PK
View Code? Open in Web Editor NEWA tool set for short variant discovery in genetic sequence data.
Home Page: http://genome.sph.umich.edu/wiki/vt
License: MIT License
A tool set for short variant discovery in genetic sequence data.
Home Page: http://genome.sph.umich.edu/wiki/vt
License: MIT License
here's my original record
1 50891 . T C 69.2 PASS AC=2;AF=0.020;AN=102;DP=178;FS=0.000;GQ_MEAN=4.18;GQ_STDDEV=2.00;InbreedingCoeff=-0.0591;MLEAC=1;MLEAF=9.804e-03;MQ=40.00;MQ0=0;NCC=116;QD=23.07;SOR=2.833;VQSLOD=2.95;culprit=FS;set=Intersection GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,32 0/0:8,0,0:8:0:0,0,221,0,221,221 0/0:21,0,0:21:63:0,63,686,63,686,686 0/0:14,0,0:14:42:0,42,487,42,487,487 0/0:6,0,0:6:0:0,0,135,0,135,135 . 0/0:3,0:3:0:0,0,33 0/0:6,0,0:6:5:0,5,169,5,169,169 0/0:1,0:1:3:0,3,33 0/0:1,0:1:3:0,3,37 0/0:2,0:2:6:0,6,69 0/0:20,0:20:57:0,57,855 0/0:1,0:1:3:0,3,30 0/0:35,0,0:35:57:0,57,977,57,977,977 0/0:11,0,0:11:33:0,33,378,33,378,378 . . . 0/0:8,0,0:8:0:0,0,210,0,210,210 0/0:6,0:6:15:0,15,225 0/0:10,0,0:10:0:0,0,132,0,132,132 0/0:1,0:1:3:0,3,28 0/0:12,0,0:12:36:0,36,372,36,372,372 0/0:21,0,0:21:34:0,34,651,34,651,651 0/0:1,0:1:3:0,3,28 0/0:1,0:1:3:0,3,32 0/0:30,0,0:30:62:0,62,929,62,929,929 0/0:24,0,0:24:39:0,39,782,39,782,782 0/0:1,0:1:3:0,3,30 0/0:3,0:3:9:0,9,100 0/1:7,4,0:11:79:79,0,191,100,203,303 . 0/0:11,0,0:11:33:0,33,382,33,382,382 0/1:5,6:11:99:152,0,109 0/0:19,0,0:19:54:0,54,810,54,810,810 0/1:14,4,0:18:69:69,0,389,111,401,512 0/0:16,0,0:16:11:0,11,496,11,496,496 0/0:2,0:2:6:0,6,65 0/0:25,0,0:25:38:0,38,800,38,800,800 0/0:1,0:1:3:0,3,27 0/1:7,7:14:99:116,0,193 0/0:11,0,0:11:33:0,33,390,33,390,390 0/0:14,0:14:39:0,39,585 0/1:3,2,0:5:47:47,0,80,56,86,142 0/0:14,0,0:14:10:0,10,344,10,344,344 . . . . 0/0:1,0:1:3:0,3,27 0/0:1,0:1:3:0,3,33 0/0:4,0:4:0:0,0,17 0/0:9,0,0:9:12:0,12,268,12,268,268 0/0:9,0,0:9:27:0,27,286,27,286,286 0/0:2,0:2:6:0,6,56 0/0:3,0,0:3:9:0,9,72,9,72,72 0/0:1,0,0:1:3:0,3,35,3,35,35 . 0/0:12,0:12:33:0,33,495 . 0/0:17,0:17:48:0,48,720 0/0:1,0:1:3:0,3,29 0/0:10,0:10:30:0,30,356 0/0:15,0,0:15:45:0,45,519,45,519,519 0/0:10,0,0:10:30:0,30,314,30,314,314 0/0:34,0,0:34:64:0,64,1085,64,1085,1085 0/0:2,0:2:6:0,6,73 0/0:7,0:7:18:0,18,270 0/0:27,0,0:27:81:0,81,910,81,910,910 . . 0/0:10,0:10:27:0,27,405 0/0:19,0:19:51:0,51,765 0/0:10,0,0:10:29:0,29,262,29,262,262 . 0/0:1,0:1:3:0,3,35 0/0:41,0,0:41:96:0,96,1347,96,1347,1347 . 0/1:14,4,0:18:99:123,0,380,165,401,566 0/0:3,0,0:3:0:0,0,33,0,33,33 0/0:14,0:14:39:0,39,585 0/0:15,0,0:15:45:0,45,515,45,515,515 . . 0/0:25,0,0:25:75:0,75,881,75,881,881 0/0:17,0,0:17:51:0,51,591,51,591,591 0/0:2,0:2:6:0,6,59 0/0:1,0:1:3:0,3,33 0/0:1,0:1:3:0,3,32 0/0:20,0,0:20:60:0,60,703,60,703,703 0/0:1,0:1:3:0,3,28 0/0:1,0:1:3:0,3,33 0/0:2,0:2:6:0,6,61 0/0:1,0:1:3:0,3,31 0/0:28,0,0:28:84:0,84,963,84,963,963 0/0:15,0,0:15:45:0,45,523,45,523,523 0/0:22,0,0:22:66:0,66,768,66,768,768 0/0:31,0,0:31:93:0,93,1057,93,1057,1057 0/0:14,0,0:14:31:0,31,423,31,423,423 0/0:11,0:11:33:0,33,408 0/0:19,0,0:19:0:0,0,481,0,481,481 0/0:4,0,0:4:0:0,0,52,0,52,52 0/0:14,0,0:14:42:0,42,494,42,494,494 0/0:8,0,0:8:24:0,24,271,24,271,271 0/1:6,3,0:9:66:66,0,163,84,172,256 0/0:12,0,0:12:9:0,9,313,9,313,313 0/0:17,0,0:17:15:0,15,551,15,551,551 0/0:1,0:1:3:0,3,34 0/0:33,0,0:33:75:0,75,1103,75,1103,1103 0/0:28,0,0:28:0:0,0,704,0,704,704 0/0:1,0:1:3:0,3,28 0/0:27,0,0:27:43:0,43,846,43,846,846 0/0:1,0:1:3:0,3,30 0/0:6,0,0:6:0:0,0,112,0,112,112 0/0:1,0:1:3:0,3,32 0/1:11,2,0:13:38:38,0,306,71,315,386 0/0:33,0,0:33:33:0,33,968,33,968,968 0/0:3,0:3:6:0,6,90 . 0/0:16,0,0:16:48:0,48,513,48,513,513 0/0:11,0,0:11:30:0,30,450,30,450,450 0/0:2,0:2:6:0,6,65 0/0:9,0,0:9:0:0,0,222,0,222,222 0/0:2,0:2:6:0,6,59 0/0:1,0:1:3:0,3,28 0/0:2,0,0:2:0:0,0,3,0,3,3 0/1:9,2,0:11:29:29,0,254,56,260,316 1/1:0,2,0:2:6:61,6,0,61,6,61 . . . 0/0:13,0:13:36:0,36,540 0/0:20,0:20:54:0,54,810 0/0:14,0:14:29:0,29,446 . . 0/0:1,0:1:3:0,3,25 0/1:12,11,3:26:99:262,0,340,241,247,701 0/0:43,0,0:43:38:0,38,1247,38,1247,1247 0/0:10,0,0:10:30:0,30,363,30,363,363 0/0:26,0,0:26:41:0,41,857,41,857,857 0/0:1,0:1:3:0,3,30 0/0:33,0,0:33:17:0,17,914,17,914,914 0/1:15,3,0:18:39:39,0,421,84,430,514 0/0:25,0,0:25:64:0,64,763,64,763,763 0/0:1,0:1:3:0,3,35 0/2:6,0,2:8:41:41,59,197,0,138,132 0/1:24,5,0:29:67:67,0,675,140,690,829 0/0:16,0,0:16:45:0,45,675,45,675,675 0/0:2,0:2:6:0,6,58 0/0:32,0,0:32:96:0,96,931,96,931,931 0/0:3,0:3:9:0,9,93 0/0:3,0:3:9:0,9,101 0/0:25,0:25:75:0,75,855 0/0:1,0:1:3:0,3,27 0/0:1,0:1:3:0,3,34 0/0:18,0:18:45:0,45,675 0/0:1,0:1:3:0,3,35 1/1:0,2,0:2:6:62,6,0,62,6,62 0/0:1,0:1:3:0,3,30 . . . . 0/0:2,0:2:3:0,3,45 1/1:0,3:3:9:94,9,0 0/0:17,0:17:45:0,45,675 . 0/0:11,0,0:11:0:0,0,295,0,295,295 0/0:9,0,0:9:27:0,27,313,27,313,313 0/1:18,6,0:24:99:113,0,497,168,515,683 0/1:15,8,3:26:99:169,0,435,149,333,659 0/0:9,0,0:9:13:0,13,276,13,276,276 0/0:2,0:2:6:0,6,68 0/0:1,0:1:3:0,3,31 0/0:1,0:1:3:0,3,34 0/0:7,0,0:7:18:0,18,270,18,270,270 0/0:2,0:2:6:0,6,50 0/0:1,0:1:3:0,3,27 0/0:21,0,0:21:63:0,63,677,63,677,677 . 0/1:5,4,0:9:97:97,0,131,112,143,255 0/0:2,0:2:6:0,6,61 0/0:2,0:2:6:0,6,70 0/0:13,0,0:13:39:0,39,449,39,449,449 0/0:15,0,0:15:0:0,0,339,0,339,339 0/2:12,0,4:16:82:82,117,427,0,309,297 . . . 0/0:1,0:1:3:0,3,33 0/0:12,0,0:12:36:0,36,413,36,413,413 0/0:13,0,0:13:39:0,39,439,39,439,439 0/0:19,0,0:19:27:0,27,614,27,614,614 1/1:0,3:3:9:112,9,0 0/0:2,0,0:2:6:0,6,66,6,66,66 0/0:6,0,0:6:0:0,0,153,0,153,153 0/0:9,0,0:9:0:0,0,243,0,243,243 . . .
and here is it after decompose -s
1 50891 . T C 69.2 PASS AC=2;AF=0.02;AN=102;DP=178;FS=0;GQ_MEAN=4.18;GQ_STDDEV=2;InbreedingCoeff=-0.0591;MLEAC=1;MLEAF=0.009804;MQ=40;MQ0=0;NCC=116;QD=23.07;SOR=2.833;VQSLOD=2.95;culprit=FS;set=Intersection GT:AD:DP:GQ:PL 0/0:1,0:1:3:0,3,32 0/0:8,0,0:8:0:0,0,221,0,221,221 0/0:21,0,0:21:63:0,63,686,63,686,686 0/0:14,0,0:14:42:0,42,487,42,487,487 0/0:6,0,0:6:0:0,0,135,0,135,135 .:.:.:.:. 0/0:3,0:3:0:0,0,33 0/0:6,0,0:6:5:0,5,169,5,169,169 0/0:1,0:1:3:0,3,33 0/0:1,0:1:3:0,3,37 0/0:2,0:2:6:0,6,69 0/0:20,0:20:57:0,57,855 0/0:1,0:1:3:0,3,30 0/0:35,0,0:35:57:0,57,977,57,977,977 0/0:11,0,0:11:33:0,33,378,33,378,378 .:.:.:.:. .:.:.:.:. .:.:.:.:. 0/0:8,0,0:8:0:0,0,210,0,210,210 0/0:6,0:6:15:0,15,225 0/0:10,0,0:10:0:0,0,132,0,132,132 0/0:1,0:1:3:0,3,28 0/0:12,0,0:12:36:0,36,372,36,372,372 0/0:21,0,0:21:34:0,34,651,34,651,651 0/0:1,0:1:3:0,3,28 0/0:1,0:1:3:0,3,32 0/0:30,0,0:30:62:0,62,929,62,929,929 0/0:24,0,0:24:39:0,39,782,39,782,782 0/0:1,0:1:3:0,3,30 0/0:3,0:3:9:0,9,100 0/1:7,4,0:11:79:79,0,191,100,203,303 .:.:.:.:. 0/0:11,0,0:11:33:0,33,382,33,382,382 0/1:5,6:11:99:152,0,109 0/0:19,0,0:19:54:0,54,810,54,810,810 0/1:14,4,0:18:69:69,0,389,111,401,512 0/0:16,0,0:16:11:0,11,496,11,496,496 0/0:2,0:2:6:0,6,65 0/0:25,0,0:25:38:0,38,800,38,800,800 0/0:1,0:1:3:0,3,27 0/1:7,7:14:99:116,0,193 0/0:11,0,0:11:33:0,33,390,33,390,390 0/0:14,0:14:39:0,39,585 0/1:3,2,0:5:47:47,0,80,56,86,142 0/0:14,0,0:14:10:0,10,344,10,344,344 .:.:.:.:. .:.:.:.:. .:.:.:.:. .:.:.:.:. 0/0:1,0:1:3:0,3,27 0/0:1,0:1:3:0,3,33 0/0:4,0:4:0:0,0,17 0/0:9,0,0:9:12:0,12,268,12,268,268 0/0:9,0,0:9:27:0,27,286,27,286,286 0/0:2,0:2:6:0,6,56 0/0:3,0,0:3:9:0,9,72,9,72,72 0/0:1,0,0:1:3:0,3,35,3,35,35 .:.:.:.:. 0/0:12,0:12:33:0,33,495 .:.:.:.:. 0/0:17,0:17:48:0,48,720 0/0:1,0:1:3:0,3,29 0/0:10,0:10:30:0,30,356 0/0:15,0,0:15:45:0,45,519,45,519,519 0/0:10,0,0:10:30:0,30,314,30,314,314 0/0:34,0,0:34:64:0,64,1085,64,1085,1085 0/0:2,0:2:6:0,6,73 0/0:7,0:7:18:0,18,270 0/0:27,0,0:27:81:0,81,910,81,910,910 .:.:.:.:. .:.:.:.:. 0/0:10,0:10:27:0,27,405 0/0:19,0:19:51:0,51,765 0/0:10,0,0:10:29:0,29,262,29,262,262 .:.:.:.:. 0/0:1,0:1:3:0,3,35 0/0:41,0,0:41:96:0,96,1347,96,1347,1347 .:.:.:.:. 0/1:14,4,0:18:99:123,0,380,165,401,566 0/0:3,0,0:3:0:0,0,33,0,33,33 0/0:14,0:14:39:0,39,585 0/0:15,0,0:15:45:0,45,515,45,515,515 .:.:.:.:. .:.:.:.:. 0/0:25,0,0:25:75:0,75,881,75,881,881 0/0:17,0,0:17:51:0,51,591,51,591,591 0/0:2,0:2:6:0,6,59 0/0:1,0:1:3:0,3,33 0/0:1,0:1:3:0,3,32 0/0:20,0,0:20:60:0,60,703,60,703,703 0/0:1,0:1:3:0,3,28 0/0:1,0:1:3:0,3,33 0/0:2,0:2:6:0,6,61 0/0:1,0:1:3:0,3,31 0/0:28,0,0:28:84:0,84,963,84,963,963 0/0:15,0,0:15:45:0,45,523,45,523,523 0/0:22,0,0:22:66:0,66,768,66,768,768 0/0:31,0,0:31:93:0,93,1057,93,1057,1057 0/0:14,0,0:14:31:0,31,423,31,423,423 0/0:11,0:11:33:0,33,408 0/0:19,0,0:19:0:0,0,481,0,481,481 0/0:4,0,0:4:0:0,0,52,0,52,52 0/0:14,0,0:14:42:0,42,494,42,494,494 0/0:8,0,0:8:24:0,24,271,24,271,271 0/1:6,3,0:9:66:66,0,163,84,172,256 0/0:12,0,0:12:9:0,9,313,9,313,313 0/0:17,0,0:17:15:0,15,551,15,551,551 0/0:1,0:1:3:0,3,34 0/0:33,0,0:33:75:0,75,1103,75,1103,1103 0/0:28,0,0:28:0:0,0,704,0,704,704 0/0:1,0:1:3:0,3,28 0/0:27,0,0:27:43:0,43,846,43,846,846 0/0:1,0:1:3:0,3,30 0/0:6,0,0:6:0:0,0,112,0,112,112 0/0:1,0:1:3:0,3,32 0/1:11,2,0:13:38:38,0,306,71,315,386 0/0:33,0,0:33:33:0,33,968,33,968,968 0/0:3,0:3:6:0,6,90 .:.:.:.:. 0/0:16,0,0:16:48:0,48,513,48,513,513 0/0:11,0,0:11:30:0,30,450,30,450,450 0/0:2,0:2:6:0,6,65 0/0:9,0,0:9:0:0,0,222,0,222,222 0/0:2,0:2:6:0,6,59 0/0:1,0:1:3:0,3,28 0/0:2,0,0:2:0:0,0,3,0,3,3 0/1:9,2,0:11:29:29,0,254,56,260,316 1/1:0,2,0:2:6:61,6,0,61,6,61 .:.:.:.:. .:.:.:.:. .:.:.:.:. 0/0:13,0:13:36:0,36,540 0/0:20,0:20:54:0,54,810 0/0:14,0:14:29:0,29,446 .:.:.:.:. .:.:.:.:. 0/0:1,0:1:3:0,3,25 0/1:12,11,3:26:99:262,0,340,241,247,701 0/0:43,0,0:43:38:0,38,1247,38,1247,1247 0/0:10,0,0:10:30:0,30,363,30,363,363 0/0:26,0,0:26:41:0,41,857,41,857,857 0/0:1,0:1:3:0,3,30 0/0:33,0,0:33:17:0,17,914,17,914,914 0/1:15,3,0:18:39:39,0,421,84,430,514 0/0:25,0,0:25:64:0,64,763,64,763,763 0/0:1,0:1:3:0,3,35 0/2:6,0,2:8:41:41,59,197,0,138,132 0/1:24,5,0:29:67:67,0,675,140,690,829 0/0:16,0,0:16:45:0,45,675,45,675,675 0/0:2,0:2:6:0,6,58 0/0:32,0,0:32:96:0,96,931,96,931,931 0/0:3,0:3:9:0,9,93 0/0:3,0:3:9:0,9,101 0/0:25,0:25:75:0,75,855 0/0:1,0:1:3:0,3,27 0/0:1,0:1:3:0,3,34 0/0:18,0:18:45:0,45,675 0/0:1,0:1:3:0,3,35 1/1:0,2,0:2:6:62,6,0,62,6,62 0/0:1,0:1:3:0,3,30 .:.:.:.:. .:.:.:.:. .:.:.:.:. .:.:.:.:. 0/0:2,0:2:3:0,3,45 1/1:0,3:3:9:94,9,0 0/0:17,0:17:45:0,45,675 .:.:.:.:. 0/0:11,0,0:11:0:0,0,295,0,295,295 0/0:9,0,0:9:27:0,27,313,27,313,313 0/1:18,6,0:24:99:113,0,497,168,515,683 0/1:15,8,3:26:99:169,0,435,149,333,659 0/0:9,0,0:9:13:0,13,276,13,276,276 0/0:2,0:2:6:0,6,68 0/0:1,0:1:3:0,3,31 0/0:1,0:1:3:0,3,34 0/0:7,0,0:7:18:0,18,270,18,270,270 0/0:2,0:2:6:0,6,50 0/0:1,0:1:3:0,3,27 0/0:21,0,0:21:63:0,63,677,63,677,677 .:.:.:.:. 0/1:5,4,0:9:97:97,0,131,112,143,255 0/0:2,0:2:6:0,6,61 0/0:2,0:2:6:0,6,70 0/0:13,0,0:13:39:0,39,449,39,449,449 0/0:15,0,0:15:0:0,0,339,0,339,339 0/2:12,0,4:16:82:82,117,427,0,309,297 .:.:.:.:. .:.:.:.:. .:.:.:.:. 0/0:1,0:1:3:0,3,33 0/0:12,0,0:12:36:0,36,413,36,413,413 0/0:13,0,0:13:39:0,39,439,39,439,439 0/0:19,0,0:19:27:0,27,614,27,614,614 1/1:0,3:3:9:112,9,0 0/0:2,0,0:2:6:0,6,66,6,66,66 0/0:6,0,0:6:0:0,0,153,0,153,153 0/0:9,0,0:9:0:0,0,243,0,243,243 .:.:.:.:. .:.:.:.:. .:.:.:.:.
note that some samples have genotype 0/2
Hi,
I'd like to use vt partition to identify the similarities and differences between variants called by different variant callers on the same set of samples.
However I'm having some issues...
partition v0.5
Options: input VCF file a platypus_chr22_normal_filt.vcf.gz
input VCF file b freebayes_chr22_normal_filt.vcf.gz
A: 663 variants
B: 609 variants
ts/tv ins/del
A-B 663 [3.04] [1.20]
A&B 0 [-nan] [-nan]
B-A 609 [3.12] [1.50]
of A 0.0%
of B 0.0%
Time elapsed: 0.02s
i.e. there are zero overlaps between variants in the two files
However, using vcftools I can see there are ~565 variant overlaps between variants in the two files:
vcf-isec -f platypus_chr22_normal_filt.vcf.gz freebayes_chr22_normal_filt.vcf.gz | grep -v ^# | wc -l
565
Any thoughts as to why vt partition would not be working? It appears to be an issue with the Freebayes VCF as when I do a comparison with a VCF generated with VarScan2 I get results as expected from vt parition:
vt partition varscan_chr22_normal.vcf platypus_chr22_normal_filt.vcf.gz
partition v0.5
Options: input VCF file a varscan_chr22_normal.vcf
input VCF file b platypus_chr22_normal_filt.vcf.gz
A: 673 variants
B: 663 variants
ts/tv ins/del
A-B 97 [2.36] [1.00]
A&B 576 [2.93] [1.50]
B-A 87 [3.73] [0.75]
of A 85.6%
of B 86.9%
Time elapsed: 0.02s
Using vt partition + varscan vcf + freebayes vcf returns 0 overlap hence why I think it is an issue with the freebayes VCF.
I have run vt partition comparing the freebayes vcf to itself and that returns as expected results:
vt partition freebayes_chr22_normal_filt.vcf.gz freebayes_chr22_normal_filt.vcf.gz
partition v0.5
Options: input VCF file a freebayes_chr22_normal_filt.vcf.gz
input VCF file b freebayes_chr22_normal_filt.vcf.gz
A: 609 variants
B: 609 variants
ts/tv ins/del
A-B 0 [-nan] [-nan]
A&B 609 [3.12] [1.50]
B-A 0 [-nan] [-nan]
of A 100.0%
of B 100.0%
Time elapsed: 0.03s
Commands for generating the Freebayes VCF were this:
Any help with this much appreciated
BW
Chris
Hi,
Thanks for developing vt - looks like it could be really helpful
I've come across an issue when using vt cat to combine VCF files generated on the same set of samples but on different chromosomes (as per the example in the docs: http://genome.sph.umich.edu/wiki/Vt#Concatenate). The chromosome name is being replaced with whatever it is in the first VCF file supplied. I've tried with both specifying the VCFs in full or using an input file list (-L)
An example of what I'm trying to do:
vt cat chr1.vcf chr2.vcf -o cat.vcf
The variants are concatenated in cat.vcf, however all the chromosome names would be converted to chr1
BW
Chris
I cannot find any documentation on what is expected for the reference fasta file for vt normalize (the -r option).
I tried using the hs37d5.fa file provided with your resource bundle. However, I get the following error:
[variant_manip.cpp:637 right_trim_or_left_extend] failure to extract base from fasta file: chr1:825765
I also tried concatenating the UCSC files for chromosomes 1-22, X, Y, and M. This gave me the same error but at a later point in the file:
[variant_manip.cpp:637 right_trim_or_left_extend] failure to extract base from fasta file: chr19:423687
My command line:
vt normalize -r hs37d5.fa Genotype.vcf.gz -o Genotype.vt.normalized.vcf
I can't share the entire input file because it is sensitive. However, I get the same error with a tiny input file containing the problem record:
chr1 825681 . AGGCGTGAGCCACTGCACCCGGCCTTGACTTC . . nc END=825712 GT .
chr1 825742 . ACAAGGGGGTTCT . . nc END=825754 GT .
chr1 825767 GS000007651-ASM_1860_L C ]1:5726936]C . PASS NS=1;SVTYPE=BND;MATEID=GS000007651-ASM_1860_R;CGA_BF=0.92 GT 1
chr1 825796 . CAGCCTGAGTGACAGAGTGAG . . nc END=825816 GT .
chr1 825826 . C . . nc END=825826 GT .
chr19 423506 . CTCGCTC . . nc END=423512 GT .
chr19 423541 . TCCTGGGGGGTCCTCCCCCCCT . . nc END=423562 GT .
chr19 423689 GS000007651-ASM_2163_R C ]19:423261]C . PASS NS=1;SVTYPE=BND;MATEID=GS000007651-ASM_2163_L;CGA_BF=0.75;CGA_XR=rs72175445;CGA_BNDG=NM_012435|-;CGA_BNDGO=NM_012435|- GT 1
chr19 425290 rs73916977 G A . PASS NS=1;AN=2;AC=1;CGA_XR=dbsnp.130|rs73916977;CGA_FI=25759|NM_012435.2|SHC2|INTRON|UNKNOWN-INC
GT:GQ:HQ:EHQ 1/0:400:400,400:398,398
chr19 426030 . A . . nc END=426030 GT .
Many thanks for any insight you can provide!
vt normalize produces an incorrect position when transforming a mitochondrial structural variation line:
ORIGINAL FILE:
M 194 . CT TC . . NS=1;AN=1;AC=1;CGA_FI=4535|-|ND1|TSS-UPSTREAM|UNKNOWN-INC&4536|-|ND2|TSS-UPSTREAM|UNKNOWN-INC&4549|-|RNR1|TSS-UPSTREAM|UNKNOWN-INC&4558|-|TRNF|TSS-UPSTREAM|UNKNOWN-INC&4565|-|TRNI|TSS-UPSTREAM|UNKNOWN-INC&4567|-|TRNL1|TSS-UPSTREAM|UNKNOWN-INC&4569|-|TRNM|TSS-UPSTREAM|UNKNOWN-INC&4577|-|TRNV|TSS-UPSTREAM|UNKNOWN-INC GT:PS:FT:GQ:HQ:EHQ:CGA_CEHQ:GL:CGA_CEGL:DP:AD:CGA_RDP 1:.:PASS:9733:9733,.:9733,.:25,.:-9733,0:-25,0:482:482,.:0
M 196 GS000012056-ASM_10_L T [M:232[CT . . NS=1;SVTYPE=BND;MATEID=GS000012056-ASM_10_R;CGA_BF=0.00 GT:FT:CGA_BNDMPC:CGA_BNDPOS:CGA_BNDDEF:CGA_BNDP 1:MPCBT:3:196:[232[CT:PRECISE
NORMALIZED FILE:
chrM 194 . CT TC . PASS NS=1;AN=1;AC=1;CGA_FI=4535|-|ND1|TSS-UPSTREAM|UNKNOWN-INC&4536|-|ND2|TSS-UPSTREAM|UNKNOWN-INC&4549|-|RNR1|TSS-UPSTREAM|UNKNOWN-INC&4558|-|TRNF|TSS-UPSTREAM|UNKNOWN-INC&4565|-|TRNI|TSS-UPSTREAM|UNKNOWN-INC&4567|-|TRNL1|TSS-UPSTREAM|UNKNOWN-INC&4569|-|TRNM|TSS-UPSTREAM|UNKNOWN-INC&4577|-|TRNV|TSS-UPSTREAM|UNKNOWN-INC GT:GQ:HQ:EHQ 1:9733:9733,.:9733,.
M 195 GS000012056-ASM_10_L T T[M:232[C . . NS=1;SVTYPE=BND;MATEID=GS000012056-ASM_10_R;CGA_BF=0;OLD_VARIANT=M:196:T/[M:232[CT GT:FT:CGA_BNDMPC:CGA_BNDPOS:CGA_BNDDEF:CGA_BNDP 1:MPCBT:3:196:[232[CT:PRECISE
C is the reference at position 195. T is the reference at 196.
[variant_manip.cpp:464 right_trim_or_left_extend] failure to extract base from fasta file: 1:2338229
[variant_manip.cpp:464 right_trim_or_left_extend] failure to extract base from fasta file: 1:2338229
I have the following variant in this window:
1 2338231 c.764_765insA T TT . . OMIM=602859.0005;dbSNP=rs61750435;GENELIST=PEX10;CLINSIG=Pathogenic;TRAIT="Peroxisomebiogenesisdisorder6A";VT=Duplication;TRANSCRIPT=NM_002617.3;ASSEMBLY=GRCh37;METHOD=Eutils
I’m a bit puzzled about the error. Is the fasta sequence not matching the allele listed in the VCF record?
I am trying to use 'vt decompose' to decompose variants from a large VCF file (~80G compressed). When I use the '-s' option, the RAM usage grows to very high levels. It appears to roughly track the size of the uncompressed input file read to that point. I don't see the problem running 'vt decompose' without the -s option. I have started trying to track down the source, but haven't found it yet.
Your help would be much appreciated. Thanks.
-Jason
It appears that using the -i option does not have any effect of the size and content of output file using vt normalize
compiled from 0d53450:
-i "22:20000000-21000000,22:10000000-11000000"
and a run without -i
produces exactly the same output
hi, on a current ubuntu 14.04 i am getting this error with the latest pull:
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o annotate_1000g.o -c annotate_1000g.cpp
In file included from annotate_1000g.h:36:0,
from annotate_1000g.cpp:24:
filter.h:30:20: fatal error: pregex.h: No such file or directory
#include "pregex.h"
^
compilation terminated.
make: *** [annotate_1000g.o] Error 1
googling and dpkg don't turn up anything for "pregex.h", is it a typo?
thanks for all your work.
mike d
Hi Adrian,
Are there any plans to make a new release on Github soon?
vt normalize doesn't cover certain cases where two variants are very close together and the right one wants to left-align past the other one.
Here is an example:
chrM reference 56-60 is ATTTT
Here are two lines from a fictitious VCF file. Together they specify ATTTT-> AGTTTT
chrM 57 . T G
chrM 59 . T TT
A correct normalization would be:
chrM 57 . T G
chrM 58 . T TT
(The ideal normalization would be a single line, but vt normalize is not intended to do anything this sophisticated:
chrM 56 . A AG )
vt incorrectly gives the below, which together specify ATTTT->ATGTTT, different from what's specified by the original
chrM 56 . A AT
chrM 57 . T G
You may find it helpful that this same issue came up with the SMaSH normalizer: https://groups.google.com/forum/#!topic/smash-benchmarking/2Vnn7OR0ug8
They addressed it by writing some collision-handling code: amplab/smash#7
I've tried running vt subset on a couple different vcf files, and I keep getting a segmentation fault: 11 error. make test works fine without errors. Any idea what might be happening? Here's the command and error:
PN105860:vt jzook$ ./vt subset -s /Users/jzook/Documents/AJTrio/NCBI_IlluminaHiSeq300X_cortex_09042015/HG002sample.txt -o /Users/jzook/Documents/AJTrio/NCBI_IlluminaHiSeq300X_cortex_09042015/AJtrio_HiSeq300X_cortex_variants_GRCh37_09042015_insgt49vt.vcf -f "DLEN>49" /Users/jzook/Documents/AJTrio/NCBI_IlluminaHiSeq300X_cortex_09042015/AJtrio_HiSeq300X_cortex_variants_GRCh37_09042015.vcf.gz
subset v0.5
Options: input VCF File /Users/jzook/Documents/AJTrio/NCBI_IlluminaHiSeq300X_cortex_09042015/AJtrio_HiSeq300X_cortex_variants_GRCh37_09042015.vcf.gz
[s] sample file list 1 samples
[f] filter DLEN>49
Segmentation fault: 11
Here are my clang and gcc versions:
PN105860:vt jzook$ clang --version
Apple LLVM version 6.0 (clang-600.0.56) (based on LLVM 3.5svn)
Target: x86_64-apple-darwin13.4.0
Thread model: posix
PN105860:vt jzook$ gcc --version
Configured with: --prefix=/Applications/Xcode.app/Contents/Developer/usr --with-gxx-include-dir=/Applications/Xcode.app/Contents/Developer/Platforms/MacOSX.platform/Developer/SDKs/MacOSX10.10.sdk/usr/include/c++/4.2.1
Apple LLVM version 6.0 (clang-600.0.56) (based on LLVM 3.5svn)
Target: x86_64-apple-darwin13.4.0
Thread model: posix
Thanks!
Justin
$ make test
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o profile_mendelian.o -c profile_mendelian.cpp
profile_mendelian.cpp:45:5: error: unknown type name 'float_t'; did you mean 'float'?
float_t min_gq;
^~~~~~~
float
profile_mendelian.cpp:463:16: error: use of undeclared identifier 'NAN'
return NAN;
^
profile_mendelian.cpp:518:26: error: use of undeclared identifier 'NAN'
return (het==0 ? NAN : hom/het);
^
profile_mendelian.cpp:573:32: error: use of undeclared identifier 'NAN'
return ((het+hom)==0 ? NAN : het/(hom+het)100);
^
4 errors generated.
make: ** [profile_mendelian.o] Error 1
Hi,
I am trying to install vt using the commands stated in the wiki at http://genome.sph.umich.edu/wiki/Vt#Installation
However, I am receiving a fatal error..
In file included from annotate_indels.cpp:24:
In file included from ./annotate_indels.h:28:
In file included from ./vntr_annotator.h:28:
In file included from ./candidate_motif_picker.h:31:
In file included from ./motif_tree.h:28:
./motif_map.h:27:10: fatal error: 'cstdint' file not foundinclude
^
1 error generated.
make: *** [annotate_indels.o] Error 1
Would appreciate any guidance.
Regards,
Saumya
Hi there,
I was wondering if you'd consider implementing a specific flag for vt normalize. We're getting an error that looks like this with some of our genomes:
Variant is not consistent: chrY:59034049-59034049 - N(REF) vs A(FASTA)
This is because it's in the PAR region and the reference we're feeding it has that masked. We don't really want to use the -n flag because we would like to catch other errors if they happen, but we'd like to ignore errors where the REF is N.
Thanks,
Denise
I have to decompose a VCF and used the instructions provided for Gemini described here:
http://gemini.readthedocs.io/en/latest/
zless $VCF \
| sed 's/ID=AD,Number=./ID=AD,Number=R/' \
| vt decompose -s - \
| vt normalize -r $REF - \
However, when I dug back into some multiallelic sites I came across this:
Original VCF -
1 4992134 rs35519208 TTATATA T,TTATATATATATATA
decomposed vcf
1 4992134 rs35519208 TTATATA T
1 4992134 rs35519208 T TTATATATA
Hello,
I have vt normalized two vcf files and when I try to merge them I get REF prefixes differ error in multiple positions. Here are the positions, REF and ALT before and after vt normalization. I couldn't understand how vt normalizing can result in different REF alleles at the same positions. Thank you for your help
file1 before vt normalization:
35301 TTAAAAAAACTTATAAACGTAAA TCAAAAAAAACTTATAAACGTAAG
file1 after normalization:
35301 T TC
file2 after normalization
35301 A AT OLD_VARIANT=gi|602625715|gb|AE004092.2|:35302:T/TT
On Mac OS X 10.9.5, make
generates error:
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o paste_and_compute_features_sequential.o -c paste_and_compute_features_sequential.cpp
paste_and_compute_features_sequential.cpp:699:9: error: use of undeclared identifier 'isnanf'; did you mean 'isnan'?
if ( isnanf(fic) ) fic = 0;
^~~~~~
isnan
/Library/Developer/CommandLineTools/usr/bin/../include/c++/v1/cmath:425:1: note: 'isnan' declared here
isnan(_A1 __x) _NOEXCEPT
^
1 error generated.
make: *** [paste_and_compute_features_sequential.o] Error 1
Shouldn't
https://github.com/atks/vt/blob/master/paste_and_compute_features_sequential.cpp#L699
be if ( isnan(fic) ) fic = 0;
?
I just read your excellent variant normalization article and decided to try processing a few of my VCF files. For a file of INDELs (produced by GATK), I received a "Floating point exception (core dumped)" exception. For other files, it worked fine. I wish I could give you something more concrete to troubleshoot, but that was the extent of the error message, and unfortunately I cannot share the variant data due to confidentiality issues. However, I will see if I can whittle my error-generating file down to check if there is a specific entry causing the exception, and I'll report back if I find anything.
The following fails reproducably on COSMIC v72 (available after registration from http://cancer.sanger.ac.uk/cosmic) on the current version.
vt cat CosmicNonCodingVariants.normalized.vcf.gz CosmicCodingMuts.normalized.vcf.gz \
| vt sort /dev/stdin -o out.vcf.gz
My system have..
$ git clone https://github.com/atks/vt.git
$ cd vt
$ make
...
make[1]: Leaving directory `/BiO/BioTools/vt/lib/libsvm'
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o align.o -c align.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o allele.o -c allele.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o annotate_1000g.o -c annotate_1000g.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o annotate_dbsnp_rsid.o -c annotate_dbsnp_rsid.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o annotate_indels.o -c annotate_indels.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o annotate_mendelian.o -c annotate_mendelian.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o annotate_regions.o -c annotate_regions.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o annotate_variants.o -c annotate_variants.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o annotate_vntrs.o -c annotate_vntrs.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o augmented_bam_record.o -c augmented_bam_record.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o bam_ordered_reader.o -c bam_ordered_reader.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o bcf_genotyping_buffered_reader.o -c bcf_genotyping_buffered_reader.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o bcf_ordered_reader.o -c bcf_ordered_reader.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o bcf_ordered_writer.o -c bcf_ordered_writer.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o bcf_synced_reader.o -c bcf_synced_reader.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o bed.o -c bed.cpp
g++ -pipe -std=c++0x -O3 -I./lib -I. -I./lib/htslib -I./lib/Rmath -I./lib/pcre2 -D__STDC_LIMIT_MACROS -o candidate_motif_picker.o -c candidate_motif_picker.cpp
candidate_motif_picker.cpp: In member function ‘bool CandidateMotifPicker::get_indel(std::string, std::string, std::string&)’:
candidate_motif_picker.cpp:186:13: error: ‘std::string’ has no member named ‘pop_back’
candidate_motif_picker.cpp:187:13: error: ‘std::string’ has no member named ‘pop_back’
make: *** [candidate_motif_picker.o] Error 1
I checked this thread. (http://stackoverflow.com/questions/20891441/using-string-pop-back-and-string-back)
Could I build vt with my system?
Building the current master fails with:
g++ -pipe -std=c++0x -O3 -ggdb -I./lib/include/ -I. -I./lib/include/htslib -I./lib/include/Rmath -D__STDC_LIMIT_MACROS -o vt align.o allele.o annotate_dbsnp_rsid.o annotate_indel.o annotate_regions.o annotate_variants.o bam_ordered_reader.o bcf_ordered_reader.o bcf_ordered_writer.o bcf_synced_reader.o bed.o candidate_motif.o cat.o chmm.o compute_concordance.o compute_features.o config.o consolidate_variants.o construct_probes.o context_filter.o decompose.o decompose_blocksub.o discover.o discover2.o estimate.o estimator.o filter.o gencode.o genome_interval.o genotype.o genotype2.o genotyping_buffer.o hts_utils.o index.o interval_tree.o interval.o lfhmm.o lhmm.o lhmm1.o lhmm_genotyping_record.o log_tool.o merge.o merge_candidate_variants.o motif_suffix_tree.o ordered_bcf_overlap_matcher.o ordered_region_overlap_matcher.o partition.o paste.o pedigree.o peek.o pileup.o profile_afs.o profile_chm1.o profile_chrom.o profile_fic_hwe.o profile_hwe.o profile_indels.o profile_len.o profile_mendelian.o profile_na12878.o profile_snps.o program.o remove_overlap.o rfhmm.o seq.o sort.o str.o subset.o sv_tree.o test.o union_variants.o uniq.o utils.o validate.o variant.o variant_manip.o view.o vntrize.o tbx_ordered_reader.o ahmm.o xcmp.o normalize.o main.o lib/include/htslib/libhts.a lib/include/Rmath/libRmath.a -lz -lpthread
discover2.o: In function `flush':
/data/zappadata_p1/matt/inbox/vt/discover2.cpp:547: undefined reference to `Pileup::diff(unsigned long, unsigned long)'
collect2: error: ld returned 1 exit status
make: *** [vt] Error 1
gcc 4.8.1
Is this not supported because there could be unrelated commas in the value?
Could decompose support splitting when Type=String?
You can see an example VCF of this here:
ftp://ftp.ncbi.nlm.nih.gov/pub/clinvar/vcf_GRCh37/clinvar_20150305.vcf.gz
where the INFO fields starting with "CLN" have comma separated values with multiple alts.
We have adjusted the header to set Number=A for INFO's we want to split.
Hi, I am running VT Decompose on a multi-sample vcf file generated by GATK as part of the preprocess workflow to load the file onto GEMINI browser and it terminates with Segmentation Fault. When I reran the command after updating VT it again failed but this time with an output file of bigger size. The command I used is as follows,
vt decompose -s -o output.vcf input.vcf
Kindly clarify.
GATK uses AD=ref,alt1,alt2...
freebayes uses RO=ref, AO=alt1,alt2
it would be nice if these were pulled when doing the decompose (and then used to recalc DP) so that they could be used downstream to derive allele frequency, etc.
Would it be possible to (optionally) output all log information to a defined file? We currently catch everything going to stderr and process to identify potential errors in our pipeline. Current implementation means we always have content in stderr and it is almost never an error. What would be great would be a --log option for all vt tools, so that log information goes to that file, errors go to stderr and the vcf/bcf goes to stdout.
I've just take a VCF file and ran normalize on it to get the following results:
1 1886346 rs35830547 G GGCC . PASS DBSNP=dbSNP_126;EA_AC=1377,3247;AA_AC=1189,1297;TAC=2566,4544;MAF=29.7794,47.8278,36.09;GTS=A1A1,A1R,RR;EA_GTC=306,765,1241;AA_GTC=406,377,460;GTC=712,1142,1701;DP=90;GL=KIAA1751;CP=0;CG=0.6;AA=.;CA=.;EXOME_CHIP=no;GWAS_PUBMED=.;FG=NM_001080484.1:utr-3;HGVS_CDNA_VAR=NM_001080484.1:c.*669_*670insCGG;HGVS_PROTEIN_VAR=.;CDS_SIZES=NM_001080484.1:2289;GS=.;PH=.;EA_AGE=.;AA_AGE=.;GRCh38_POSITION=1:1954908;OLD_VARIANT=1:1886347:G/GCCG
1 1886346 ~rs35830547 G GGCC . PASS DBSNP=dbSNP_126;EA_AC=1375,3249;AA_AC=1194,1296;TAC=2569,4545;MAF=29.7362,47.9518,36.1119;GTS=A1A1,A1R,RR;EA_GTC=305,765,1242;AA_GTC=408,378,459;GTC=713,1143,1701;DP=90;GL=KIAA1751;CP=0;CG=0.2;AA=.;CA=.;EXOME_CHIP=no;GWAS_PUBMED=.;FG=NM_001080484.1:utr-3;HGVS_CDNA_VAR=NM_001080484.1:c.*668_*669insGCG;HGVS_PROTEIN_VAR=.;CDS_SIZES=NM_001080484.1:2289;GS=.;PH=.;EA_AGE=.;AA_AGE=.;GRCh38_POSITION=1:1954909;OLD_VARIANT=1:1886348:C/CCGC
1 1886346 ~rs35830547 G GGCC . PASS DBSNP=dbSNP_126;EA_AC=1374,3246;AA_AC=1190,1296;TAC=2564,4542;MAF=29.7403,47.8681,36.0822;GTS=A1A1,A1R,RR;EA_GTC=305,764,1241;AA_GTC=406,378,459;GTC=711,1142,1700;DP=88;GL=KIAA1751;CP=0;CG=-0.3;AA=.;CA=.;EXOME_CHIP=no;GWAS_PUBMED=.;FG=NM_001080484.1:utr-3;HGVS_CDNA_VAR=NM_001080484.1:c.*667_*668insGGC;HGVS_PROTEIN_VAR=.;CDS_SIZES=NM_001080484.1:2289;GS=.;PH=.;EA_AGE=.;AA_AGE=.;GRCh38_POSITION=1:1954910;OLD_VARIANT=1:1886349:C/CGCC
but then when I run uniq, only one of the 'OLD_VARIANT' tags is added
1 1886346 ~rs35830547 G GGCC . PASS DBSNP=dbSNP_126;EA_AC=1374,3246;AA_AC=1190,1296;TAC=2564,4542;MAF=29.7403,47.8681,36.0822;GTS=A1A1,A1R,RR;EA_GTC=305,764,1241;AA_GTC=406,378,459;GTC=711,1142,1700;DP=88;GL=KIAA1751;CP=0;CG=-0.3;AA=.;CA=.;EXOME_CHIP=no;GWAS_PUBMED=.;FG=NM_001080484.1:utr-3;HGVS_CDNA_VAR=NM_001080484.1:c.*667_*668insGGC;HGVS_PROTEIN_VAR=.;CDS_SIZES=NM_001080484.1:2289;GS=.;PH=.;EA_AGE=.;AA_AGE=.;GRCh38_POSITION=1:1954910;OLD_VARIANT=1:1886349:C/CGCC
It would be good to carrier the INFO field for all of them.
in recent version, when running decompose and normalize, the header gets these lines:
##INFO=<ID=,Number=1,Type=String,Description="Original chr:pos:ref:alt encoding">
##INFO=<ID=OLD_VARIANT,Number=.,Type=String,Description="Original chr:pos:ref:alt encoding">
The former, without an ID, causes problems in downstream parsers.
I'm running as:
vt decompose -s $VCF | vt normalize -r $REF -
Adrian;
Apologies, one more report this morning. The htslib currently in vt has a dependency on gcc 4.5 or better. This got fixed yesterday in devel so it'll be compatible with older versions:
samtools/bcftools#201 (comment)
Would it be possible to update htslib in vt to pull in this fix? Thanks much.
Hi,
Is there a test suite available for post-installation validation?
thanks!
Deanna
I get the following error after make commande
complex_genotyping_record.cpp:318:27: error: ‘isnan’ was not declared in this scope
Hello,
Question. After a decompose should certain INFO tags be changed to reflect the one line, one ALT output? i.e. Number=A --> Number=1
? I got an error with a tool expecting it.
##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele">
Similar to issue #45 we're also getting the following error:
[variant_manip.cpp:96 is_not_ref_consistent] reference bases not consistent: chrX:60000-60000 c(REF) vs C(FASTA)
[normalize.cpp:209 normalize] Normalization not performed due to inconsistent reference sequences. (use -n or -m option to relax this)
and incidentally we are using both the -n and the -m options.
Hi,
I have a bunch of Complete Genomics VCF files that I want to normalize. They're compressed with bzip2 and they have the following header start:
Right now vt normalize throws:
[bcf_ordered_reader.cpp:49 BCFOrderedReader] Not a VCF/BCF file
vt normalize vcfBeta-ASM.vcf.bz2 -o normVcf.out -r hg19_CGI.fa.bz2
Please update to allow these files to be normalized.
Thanks,
Denise
I'd love to do a filter + normalization at the same time. We're filtering on variants and piping this back into vt normalize. Be so much better if we could filter and normalize at the same time in the same process to reduce memory and I/O.
A header line containing extra whitespace outside of the "<...>" content can lead to missing VCF columns in the output. Here's an example input VCF containing a header line line with about 60 trailing space characters in the last FILTER header line, right before the first FORMAT line. This will look like a blank line in this window; scroll all the way right to see the newline quote character:
Input VCF file contents:
##fileformat=VCFv4.1
##fileDate=20150126
##reference=hs37d5
##phasing=partial
##FILTER=<ID=INDEL_SPECIFIC_FILTERS,Description="QD < 2.0 || ReadPosRankSum < -20.0 || InbreedingCoeff < -0.8 || FS > 200.0">
##FILTER=<ID=LowQual,Description="Low quality">
##FILTER=<ID=VQSRTrancheSNP99.00to99.90,Description="Truth sensitivity tranche level for SNP model at VQS Lod: -6.6778 <= x < -0.6832">
##FILTER=<ID=VQSRTrancheSNP99.90to100.00+,Description="Truth sensitivity tranche level for SNP model at VQS Lod < -36469.5723">
##FILTER=<ID=VQSRTrancheSNP99.90to100.00,Description="Truth sensitivity tranche level for SNP model at VQS Lod: -36469.5723 <= x < -6.6778"> \
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">
##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
##FORMAT=<ID=GATK,Number=1,Type=String,Description="Genotype as called by GATK. Always a diploid call. All other genotype stats based on this genotype.">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype after Personalis post-processing to match detected chromosome counts.">
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001
1 12065947 PTV001 C T,A 29 PASS . GT:GATK:AD:DP:GQ 0/1:0/1:3,2:5:19
1 109817590 PTV002 G T 77 PASS . GT:GATK:AD:DP:GQ 0/1:0/1:3,2:5:20
1 153791300 PTV003 CTG C 81 PASS . GT:GATK:AD:DP:GQ 0/1:0/1:3,2:5:21
1 156104666 PTV004 TTGAGAGCCGGCTGGCGGAT TCC 30 PASS . GT:GATK:AD:DP:GQ 0/1:0/1:3,2:5:22
1 156108541 PTV005 G GG 31 PASS . GT:GATK:AD:DP:GQ 0/1:0/1:3,2:5:23
1 161279695 PTV006 T C,A 32 PASS . GT:GATK:AD:DP:GQ 0/1:0/1:3,2:5:24
1 169519049 PTV007 T . 35 PASS . GT:GATK:AD:DP:GQ 0/1:0/1:3,2:5:24
1 226125468 PTV097 G A 99 PASS . GT:GATK:AD:DP:GQ 0/1:0/1:3,2:5:109
16 2103394 PTV056 C T 68 PASS . GT:GATK:AD:DP:GQ 0/1:0/1:3,2:5:72
4 31789170 PTV021 G . 77 PASS . GT:GATK:AD:DP:GQ 0/1:0/1:3,2:5:38
Output VCF file data:
Two of the variants in this input get normalized, and vt terminates normally. However, the output VCF is lacking the FORMAT and genotype columns:
#CHROM POS ID REF ALT QUAL FILTER INFO
1 12065947 PTV001 C T,A 29 PASS .
1 109817590 PTV002 G T 77 PASS .
1 153791300 PTV003 CTG C 81 PASS .
1 156104667 PTV004 TGAGAGCCGGCTGGCGGAT CC 30 PASS OLD_VARIANT=1:156104666:TTGAGAGCCGGCTGGCGGAT/TCC
1 156108540 PTV005 C CG 31 PASS OLD_VARIANT=1:156108541:G/GG
1 161279695 PTV006 T C,A 32 PASS .
1 169519049 PTV007 T . 35 PASS .
1 226125468 PTV097 G A 99 PASS .
16 2103394 PTV056 C T 68 PASS .
4 31789170 PTV021 G . 77 PASS .
I'm using vt software v0.5 (released/downloaded on 2015-06-24)
There has been > 200 commits since, and i'd like to package it for homebrew.
Breaking up MNPs and other complex variants loses information about which variants occur on the same haplotype. To avoid this, decompose_blocksub could output phased genotypes (i.e. | instead of /) and PS tags in the per-sample data
Example:
##fileformat=VCFv4.1
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##contig=<ID=11,length=135006516>
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT S1 S2 S3 S4
11 101 . GCGT G,GCGA,GTGA,CCGT 199 PASS . GT 0/1 1/2 2/3 2/4
The vt decompose -s | vt normalize
output is (irrelevant fields are skipped):
11 101 GCGT G 0/1 1/. ./. ./.
11 101 G C 0/. ./. ./. ./1
11 102 CGT TGA 0/. ./. ./1 ./.
11 104 T A 0/. ./1 1/. 1/.
But I tend to believe the right one should be:
11 101 GCGT G 0/1 1/. ./. ./.
11 101 G C 0/. ./0 0/0 0/1
11 102 C T 0/. ./0 0/1 0/0
11 104 T A 0/. ./1 1/1 1/0
There are two problems with the vt
output. Firstly, CGT=>TGA
has not been decomposed. Secondly, several .
should be replaced with the reference 0
. For example, in sample S3, the original genotype is 2/3
. Both allele 2
and 3
have the reference base at 11:101
. The genotype at 101:G=>C
should be 0/0
, not ./.
. To do the decompose right, vt
needs to be aware of the allele sequences. BTW, also note that at 11:104
, S3 has a homozygous A/A
genotype, although in the original VCF, 2/3
appears to be a heterozygote.
EDIT: err... actually there is no "GCGT" on human chr11. Nonetheless, if we change coordinate to 61842 where there is a GCGT on the reference, the output is the same.
I'm getting this error when trying to run vt genotype
[parlar@mps 12191-96]$ vt genotype -r /home/bcbio_root/share/bcbio/genomes/Hsapiens/hg19/seq/hg19.fa -s 12191-96 -b 12191-96-ready.bam -o 12191-96-ensemble.vcf.gz.norm.decomp.vcf.gz.vt.vcf 12191-96-ensemble.vcf.gz.norm.decomp.vcf
[E::bcf_hdr_add_sample] Duplicated sample name '12191-96'
Aborted (core dumped)
Not setting -s
also produces a complaint:
vt genotype -r /home/bcbio_root/share/bcbio/genomes/Hsapiens/hg19/seq/hg19.fa -b 12191-96-ready.bam -o 12191-96-ensemble.vcf.gz.norm.decomp.vcf.gz.vt.vcf 12191-96-ensemble.vcf.gz.norm.decomp.vcf
undefined -- Required argument missing: s
genotype v0.5
description : Genotypes variants for each sample.
usage : vt genotype [options] <in.vcf>
options : -d debug alignments
-r reference FASTA file
-s sample ID
-o output VCF file
-b input BAM file
-I file containing list of intervals []
-i intervals []
-? displays help
What I want to do is to extract allelic frequencies and possibly other params in the bam alignment for pre-specified variants (in a vcf). I'm not even sure that vt will do the job ... ? Any suggestions on how to do this in the best way is also greatly appreciated. Have tried Mutect2, which takes ages, freebayes but which does not call all input variants.
Kind regards,
Pär Larsson
Dear Adrian,
I'm having a compilation error as following, could you share some idea on a fix please?
bed.cpp: In member function ‘std::string BEDRecord::to_string()’:
bed.cpp:63: error: call of overloaded ‘to_string(int32_t&)’ is ambiguous
/usr/lib/gcc/x86_64-redhat-linux/4.4.7/../../../../include/c++/4.4.7/bits/basic_string.h:2604: note: candidates are: std::string std::to_string(long long int)
/usr/lib/gcc/x86_64-redhat-linux/4.4.7/../../../../include/c++/4.4.7/bits/basic_string.h:2610: note: std::string std::to_string(long long unsigned int)
/usr/lib/gcc/x86_64-redhat-linux/4.4.7/../../../../include/c++/4.4.7/bits/basic_string.h:2616: note: std::string std::to_string(long double)
bed.cpp:63: error: call of overloaded ‘to_string(int32_t&)’ is ambiguous
/usr/lib/gcc/x86_64-redhat-linux/4.4.7/../../../../include/c++/4.4.7/bits/basic_string.h:2604: note: candidates are: std::string std::to_string(long long int)
/usr/lib/gcc/x86_64-redhat-linux/4.4.7/../../../../include/c++/4.4.7/bits/basic_string.h:2610: note: std::string std::to_string(long long unsigned int)
/usr/lib/gcc/x86_64-redhat-linux/4.4.7/../../../../include/c++/4.4.7/bits/basic_string.h:2616: note: std::string std::to_string(long double)
make: *** [bed.o] Error 1
When subsetting a vcf file, it would be useful to trim all alleles from a multiallelic site that are not present in the samples being subsetted on. For example, consider the following entry
1 100 . CTTT CT,C 100 PASS ... 0/2 ...
The genotype for the sample being subsetted on is 0/2, so when subsetting, this record needs to be retained, but there is no need to retain the 'CT' allele. This also requires all INFO fields with an entry for each alternate allele to be trimmed.
It is possible to use 'vt decompose | vt subset' to get rid of the alternate allele that isn't present, but this will modify the values supplied in the genotype fields, so isn't necessarily a desirable solution.
with this VCF:
wget https://s3.amazonaws.com/biodata/variants/cosmic-v68-GRCh37.vcf.gz
this command:
vt decompose cosmic-v68-GRCh37.vcf.gz \
| vt normalize -r /data/human/b37/human_g1k_v37_decoy.fasta - > vv.vcf
puts some data in the output, but then it stalls after 77K lines or so.
Hi,
I have below indel detected by Freebayes:
chr10 88679046 . GAGCCCTG GTGTAG
After running the normalization using vt, it became:
chr10 88679047 . AGCCCT TGTA
This is incorrect representation based on VCF spec. It should be:
chr10 88679046 . GAGCCCT GTGTA
Please let me know if it is possible to normalize in correct way.
Thanks
Savi
paste_genotypes.cpp:729:9: error: use of undeclared identifier 'isnanf'; did you mean 'isnan'?
if ( isnanf(fic) ) fic = 0;
^~~~~~
isnan
Changing to isnan allows successful compilation
Using this source https://github.com/atks/vt/archive/0.577.tar.gz
% vt view
...
view v0.5
I was expecting to see view v0.557
?
1 159030 . TACCTTTC TGACCTTTT 0.04 . .
This is decomposed by decompose_blocksub with -a option to
1 159030 . T TG 0.04 . .
1 159037 . C T 0.04 . .
However, if the given normalized version of the variant is
1 159031 . ACCTTTC GACCTTTT 0.04 . .
It is not possible to know that a padding T is required as the alignment will be:
-ACCTTTC
GACCTTTT
We will need decompose_blocksub to have access to the reference genome to allow for the padding of the variant on the left hand side before performing the Needle-Wunsch alignment or to add the relevant T after decomposition.
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.