marvin-jens / find_circ Goto Github PK
View Code? Open in Web Editor NEWtools to find circRNAs in RNA-seq data
License: GNU General Public License v3.0
tools to find circRNAs in RNA-seq data
License: GNU General Public License v3.0
My dear professor:
this process is 10min
bowtie2 -p 20 --reorder --mm --score-min=C,-15,0 -q -x /ref/boetiew2_index_rice -U anchors.fq.gz -S bowtieresult.sam
this process need 2hours:
bowtie2 -p 20 --reorder --mm --score-min=C,-15,0 -q -x /ref/boetiew2_index_rice -U anchors.fq.gz | find_circ.py --genome=genome.fa --prefix=find_circ --name=result --stats=stats.txt > splice_sites.bed
How can we let the speed faster
bowtie2 -q -U unmapped.fastq -x /Drive1/find_circ/index/bow2_homo --reorder --mm --very-sensitive --score-min=C,-15,0 | /home/aclab/apps/find_circ/find_circ.py -G /home/aclab/homo.fa -p homo --stats homo_sites.log --reads homo.fa >homo.bed
[E::sam_parse1] query name too long
[W::sam_read1] Parse error at line 643
Traceback (most recent call last):
File "/home/aclab/apps/find_circ/find_circ.py", line 705, in
sam_line = pair_num * 2
NameError: name 'pair_num' is not defined
""I used single read fastq file and it varies in length and the unmapped fastq file look like::
bf0c7879-f557-4fd4-bbfa-2e789855dc27_A__TTTGACCAAGAAGAGATACGGTGCTTCTGCCGGTAACGTCGGTGACGAAGGTGGTGTTGCTCCAAACATTCAAACCGCTGAAGAAGCTTGGACTTGATTGTTGACGCCATCAAGGCTGCTGGTCACGACGGTAAGGTCAAGATCGGTTTGGACTGTGCTCTGAATTCTTCAAGGACGGTAAGTACGACTTGGACTTAGAACCCAGAATCTGACAAATCCAAGTGGTTGACTGGTGTCGAATTGGCTAGACATGTACCGCCTTGATGAAGAGATACCCAATTGTCTCCATCGAAGATCCATTTGCTGAAAGATGACTGGGAAGCTTGGGTCTCACTTCAAGACCGCTGGTATCCAAATTGTTGCTGATGACTTGACTGTCACCAACCCAGCTAGAATTATACCGCCATCGAAAGAAGGCTGCTGACGCTTTGGTTAGCGTTGAAGGTTAACCAAATCGGTACCTTGTCTGAATCCATCAAGGCTGCTCAAGACTTCGCAGCCAACTGGGTGTCATGGTTTCCCACAGATCTGGCTGAAACTGAAGACACTTTCTCATTGCTGACTTGGTTGTCGGTTTGAAGAACTGGTCAAATCAAGACTGGTGCTCCAGCTAGATCCGAAAGATTGGCTAAGTTGAACCAATTGTTGAGAATCGAAGAAGAATTGGGTGACAAGGCTGTCTATGCCGGTAG
TTTGACCAAGAAGAGATACG
+
(
@bf0c7879-f557-4fd4-bbfa-2e789855dc27_B
AAGGCTGTCTATGCCGGTAG
+
??86*+6,(*((0217:'$.
837dd288-73fd-40ab-9acb-4e3a455c0562_A__AATTCATGATTGCCTTAACTGGTGCTAAGACCTCTGAAGCCAAAGAATTGGTTCCGGTTTACCACAACTTGAAGTCTTTGACCAAGAAGAGATTCGGTGCTTCTGCCGGTAACGTCGGTGACGAAGGTGGTGTTGCTCCAAACATTCAAACCGCTGAAGAAGCTTTGGACTTGATTGTTGACGCTATCAAGGCTGCTGGTCACACGGTAAGGTCAAGATCGGTTTGGACTGTGCCACCTTGAATTCAAGGACGGTAAGTACGACTTGGACTCAAGAACCCAGAAATCTGACAAATCCAAGTGGTTGACTGGTGTCGAATTGGCTGACATGTACCATTTCCTTGATGAAGAGATACTCAATTGTCTCCATCGAAGATCCATTTGCTGAAGATGACTGGGAAGCTTGGTCTCATTTTCAAGACCGTTGGTATCCAAATATCGTTGATGACTTGACTGTCACCATTCCCGGCTAGAATTCGCCAAAGAAGGCTGCTGACGCTTTGTTGTTGAAGTTAACCAATTCAAGTACCTTGTCTGAAACCCATCAAGGCTGCTCAAGACTCATTGCCAACTTGGGGTGTCATGGTTTCCCACAGATCTGGTGAAAACTGAAGACTTCATTGCTGACTTGGTTGTCGGTTTGAGAACGGTCAAATCAAGACTGGTGCTCCAGCTAGATCCGAAAAGATTGGCTAAGTTGAACCAATTGTGAGAATCGAAGAAGAATTGGGTGACAAGGCTGTCTACGCCGGTG
AATTCATGATTGCCTTAACT
So plz can you tell me is it possible to run find_circ on this fastq file. If yes then please suggest me.
Thanks in advance
Dear Marvin Jens,
Good day!
I am currently using the find_circ program developed by you for my work. I noticed there are additional arguments (--stranded & --strandpref). May I know the function of these two arguments?
I have single end RNA-seq reads and I would like to identify circRNAs using find_circ. Should I include the --stranded and --strandpref argument in my analysis?
Are these two argument only use for stranded specific paired end reads?
Thank you.
Best regards,
Teo
The README says:
For non-commercial purposes the code is released under the General Public License (version 3). See the file LICENSE for more detail. If you are interested in commercial use of this software contact the authors
The GPL grants permission to use the software for any purpose. In fact, the GPL contains a clause that permits users to remove the additional non-commercial restriction:
If the Program as you received it, or any part of it, contains a notice stating that it is
governed by this License along with a term that is a further restriction, you may remove that term.
https://github.com/marvin-jens/find_circ/blob/master/LICENSE#L389
As per the license the statement in the README has no effect.
Note that restricting usage permissions means that the software is non-free and cannot be redistributed in free software repositories (such as GNU Guix or Debian).
I encourage you to clarify the license statement and release the sources under GPLv3 or later.
Hello, Marvin Jens,
I'm using your software for plant circRNA identification, however, the "-G (--genome)" option doesn't work with the Error 24 "too many open files", because of the draft reference genome (ten thousands of scaffolds, resulting in ten thousands of file for the option). And also, I found that only provide the single genome fasta file doesn't work also. I looks the option only accept separated chromosome fasta files.
I'm wondering is there any solutions to solve this? Or, could you have some suggestions?
Thank you.
I was wondering that the fuzzy search in merge_bed.py gives me the same results as without the fuzzy search.
I looked into merge_bed.py and saw that this option is never used. Is there any reason to call the function read_to_hash
with parameter flank always with 0 in line 49?
inputs = [read_to_hash(a,flank=0) for a in args]
Will it work if I replace the zero with options.flank?
inputs = [read_to_hash(a,flank=options.flank) for a in args]
i have a question, what's the different of find_circ and bwa-mem_find_circ programes?
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.