pachterlab / seqspec Goto Github PK

conda create --name seqspec
conda activate seqspec

conda install pip
pip install git+https://github.com/IGVF/seqspec.git

conda list
# packages in environment at /Users/choo/opt/anaconda3/envs/seqspec:
#
# Name                    Version                   Build  Channel
attrs                     23.1.0                   pypi_0    pypi
bzip2                     1.0.8                h1de35cc_0  
ca-certificates           2023.08.22           hecd8cb5_0  
jsonschema                4.19.0                   pypi_0    pypi
jsonschema-specifications 2023.7.1                 pypi_0    pypi
libffi                    3.4.4                hecd8cb5_0  
ncurses                   6.4                  hcec6c5f_0  
newick                    1.9.0                    pypi_0    pypi
openssl                   3.0.10               hca72f7f_2  
pip                       23.2.1                   pypi_0    pypi
python                    3.11.5               hf27a42d_0  
pyyaml                    6.0.1                    pypi_0    pypi
readline                  8.2                  hca72f7f_0  
referencing               0.30.2                   pypi_0    pypi
rpds-py                   0.10.3                   pypi_0    pypi
seqspec                   0.0.0                    pypi_0    pypi
setuptools                68.0.0                   pypi_0    pypi
sqlite                    3.41.2               h6c40b1e_0  
tk                        8.6.12               h5d9f67b_0  
tzdata                    2023c                h04d1e81_0  
wheel                     0.38.4                   pypi_0    pypi
xz                        5.4.2                h6c40b1e_0  
zlib                      1.2.13               h4dc903c_0  



seqspec --help
Traceback (most recent call last):
  File "/Users/choo/opt/anaconda3/envs/seqspec/bin/seqspec", line 5, in <module>
    from seqspec.main import main
  File "/Users/choo/opt/anaconda3/envs/seqspec/lib/python3.11/site-packages/seqspec/main.py", line 4, in <module>
    from .seqspec_format import setup_format_args, validate_format_args
  File "/Users/choo/opt/anaconda3/envs/seqspec/lib/python3.11/site-packages/seqspec/seqspec_format.py", line 1, in <module>
    from seqspec.utils import load_spec
  File "/Users/choo/opt/anaconda3/envs/seqspec/lib/python3.11/site-packages/seqspec/utils.py", line 5, in <module>
    import requests
ModuleNotFoundError: No module named 'requests'

pip install requests # requests 2.31.0 (pypi_0) installed
seqspec --help # launches as expected

modified   seqspec/seqspec_index.py
@@ -285,6 +285,17 @@ def format_zumis(indices, subregion_type=None):
     return "\n".join(xl)[:-1]
 
 
+def stable_deduplicate_fqs(fqs):
+    # stably deduplicate gdna_fqs
+    seen_fqs = set()
+    deduplicated_fqs = []
+    for r in fqs:
+        if r not in seen_fqs:
+            deduplicated_fqs.append(r)
+            seen_fqs.add(r)
+    return deduplicated_fqs
+
+
 def format_chromap(indices, subregion_type=None):
     bc_fqs = []
     bc_str = []
@@ -306,8 +317,9 @@ def format_chromap(indices, subregion_type=None):
         raise Exception("chromap only supports genomic dna from two fastqs")
 
     barcode_fq = bc_fqs[0]
-    read1_fq = list(set(gdna_fqs))[0]
-    read2_fq = list(set(gdna_fqs))[1]
+    deduplicated_gdna_fqs = stable_deduplicate_fqs(gdna_fqs)
+    read1_fq = deduplicated_gdna_fqs[0]
+    read2_fq = deduplicated_gdna_fqs[1]
     read_str = ",".join([f"r{idx}:{ele}" for idx, ele in enumerate(gdna_str, 1)])
     bc_str = ",".join(bc_str)
 

python3 -m seqspec.main check ./assays/BD-Rhapsody-EB/spec.yaml                        
[error 1] {'name': 'BD-Rhapsody-EB', 'doi': 'https://scomix.bd.com/hc/en-us/articles/6990647359501-Rhapsody-WTA-De
mo-Datasets-with-Enhanced-Cell-Capture-Beads', 'publication_date': '31 August 2022', 'description': 'BD Rhapsody W
TA is a nanowell-based commercial system that uses a split-pool (Enahnced Beads-v2) approach to generate oligos on
 magnetic beads.', 'modalities': ['RNA'], 'lib_struct': 'https://teichlab.github.io/scg_lib_structs/methods_html/B
D_Rhapsody.html', 'assay_spec': [{'region_id': 'RNA', 'region_type': 'RNA', 'name': 'RNA', 'sequence_type': 'joine
d', 'onlist': None, 'sequence': 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTXNNNNNNNNNGTGANNNNNNNNN
GACANNNNNNNNNNNNNNNNNXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG', 'min_len': 169, 'max_l
en': 366, 'regions': [{'region_id': 'illumina_p7', 'region_type': 'illumina_p7', 'name': 'illumina_p7', 'sequence_
type': 'fixed', 'onlist': None, 'sequence': 'AATGATACGGCGACCACCGAGATCTACAC', 'min_len': 29, 'max_len': 29, 'region
s': None}, {'region_id': 'truseq_r1', 'region_type': 'truseq_r1', 'name': 'truseq_r1', 'sequence_type': 'fixed', '
onlist': None, 'sequence': 'TCTTTCCCTACACGACGCTCTTCCGATCT', 'min_len': 29, 'max_len': 29, 'regions': None}, {'regi
on_id': 'vb', 'region_type': 'vb', 'name': 'vb', 'sequence_type': 'onlist', 'onlist': {'filename': 'vb_onlist.txt'
, 'md5': None}, 'sequence': 'X', 'min_len': 0, 'max_len': 3, 'regions': None}, {'region_id': 'cls1', 'region_type'
: 'cls1', 'name': 'cls1', 'sequence_type': 'onlist', 'onlist': {'filename': 'cls1_onlist.txt', 'md5': None}, 'sequ
ence': 'NNNNNNNNN', 'min_len': 9, 'max_len': 9, 'regions': None}, {'region_id': 'linker1', 'region_type': 'linker1
', 'name': 'linker1', 'sequence_type': 'fixed', 'onlist': None, 'sequence': 'GTGA', 'min_len': 4, 'max_len': 4, 'r
egions': None}, {'region_id': 'cls2', 'region_type': 'cls2', 'name': 'cls2', 'sequence_type': 'onlist', 'onlist': 
{'filename': 'cls2_onlist.txt', 'md5': None}, 'sequence': 'NNNNNNNNN', 'min_len': 9, 'max_len': 9, 'regions': None
}, {'region_id': 'linker2', 'region_type': 'linker2', 'name': 'linker2', 'sequence_type': 'fixed', 'onlist': None,
 'sequence': 'GACA', 'min_len': 4, 'max_len': 4, 'regions': None}, {'region_id': 'cls3', 'region_type': 'cls3', 'n
ame': 'cls3', 'sequence_type': 'onlist', 'onlist': {'filename': 'cls3_onlist.txt', 'md5': None}, 'sequence': 'NNNN
NNNNN', 'min_len': 9, 'max_len': 9, 'regions': None}, {'region_id': 'umi', 'region_type': 'umi', 'name': 'umi', 's
equence_type': 'random', 'onlist': None, 'sequence': 'NNNNNNNN', 'min_len': 8, 'max_len': 8, 'regions': None}, {'r
egion_id': 'polyT', 'region_type': 'polyT', 'name': 'polyT', 'sequence_type': 'random', 'onlist': None, 'sequence'
: 'X', 'min_len': 1, 'max_len': 98, 'regions': None}, {'region_id': 'cdna', 'region_type': 'cdna', 'name': 'cdna',
 'sequence_type': 'random', 'onlist': None, 'sequence': 'X', 'min_len': 1, 'max_len': 98, 'regions': None}, {'regi
on_id': 'truseq_r2', 'region_type': 'truseq_r2', 'name': 'truseq_r2', 'sequence_type': 'fixed', 'onlist': None, 's
equence': 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC', 'min_len': 34, 'max_len': 34, 'regions': None}, {'region_id': 'sam
ple_index', 'region_type': 'sample_index', 'name': 'sample_index', 'sequence_type': 'onlist', 'onlist': {'filename
': 'sample_index_onlist.txt', 'md5': None}, 'sequence': 'NNNNNNNN', 'min_len': 8, 'max_len': 8, 'regions': None}, 
{'region_id': 'illumina_p7', 'region_type': 'illumina_p7', 'name': 'illumina_p7', 'sequence_type': 'fixed', 'onlis
t': None, 'sequence': 'ATCTCGTATGCCGTCTTCTGCTTG', 'min_len': 24, 'max_len': 24, 'regions': None}]}]} is not of typ
e 'object' in spec[]

[error 1] 'order' is a required property in spec['assay_spec'][0]['regions'][0]
[error 2] 'order' is a required property in spec['assay_spec'][0]['regions'][1]
[error 3] None is not of type 'string' in spec['assay_spec'][0]['regions'][2]['onlist']['md5']
[error 4] 'order' is a required property in spec['assay_spec'][0]['regions'][2]
[error 5] None is not of type 'string' in spec['assay_spec'][0]['regions'][3]['onlist']['md5']
[error 6] 'order' is a required property in spec['assay_spec'][0]['regions'][3]
[error 7] 'order' is a required property in spec['assay_spec'][0]['regions'][4]
[error 8] None is not of type 'string' in spec['assay_spec'][0]['regions'][5]['onlist']['md5']
[error 9] 'order' is a required property in spec['assay_spec'][0]['regions'][5]
[error 10] 'order' is a required property in spec['assay_spec'][0]['regions'][6]
[error 11] None is not of type 'string' in spec['assay_spec'][0]['regions'][7]['onlist']['md5']
[error 12] 'order' is a required property in spec['assay_spec'][0]['regions'][7]
[error 13] 'order' is a required property in spec['assay_spec'][0]['regions'][8]
[error 14] 'order' is a required property in spec['assay_spec'][0]['regions'][9]
[error 15] 'order' is a required property in spec['assay_spec'][0]['regions'][10]
[error 16] 'order' is a required property in spec['assay_spec'][0]['regions'][11]
[error 17] None is not of type 'string' in spec['assay_spec'][0]['regions'][12]['onlist']['md5']
[error 18] 'order' is a required property in spec['assay_spec'][0]['regions'][12]
[error 19] 'order' is a required property in spec['assay_spec'][0]['regions'][13]
[error 20] 'order' is a required property in spec['assay_spec'][0]

~/proj/seqspec/seqspec/seqspec_print.py:94: UserWarning: constrained_layout not applied because axes sizes collapsed to zero.  Try making figure larger or axes decorations smaller.
  s.savefig(o, dpi=300, bbox_inches="tight")

[error 1] IGVF_neuro_S1_R2_001.fastq.gz does not exist
[error 2] IGVF_neuro_S1_R1_001.fastq.gz does not exist
[error 3] IGVF_neuro_S1_R3_001.fastq.gz does not exist
[error 4] IGVF_neuro_S1_R2_001.fastq.gz does not exist
[error 5] IGVF_neuro_S1_R1_001.fastq.gz does not exist
[error 6] IGVF_neuro_S1_R3_001.fastq.gz does not exist
[error 7] IGVF_neuro_S1_R2_001.fastq.gz does not exist
[error 8] IGVF_neuro_S1_R1_001.fastq.gz does not exist
[error 9] IGVF_neuro_S1_R3_001.fastq.gz does not exist
[error 10] region_id 'IGVF_neuro_S1_R2_001.fastq.gz' is not unique across all regions
[error 11] region_id 'adapter_fwd' is not unique across all regions
[error 12] region_id 'IGVF_neuro_S1_R1_001.fastq.gz' is not unique across all regions
[error 13] region_id 'IGVF_neuro_S1_R3_001.fastq.gz' is not unique across all regions
[error 14] region_id 'adapter_rev' is not unique across all regions
[error 15] region_id 'IGVF_neuro_S1_R2_001.fastq.gz' is not unique across all regions
[error 16] region_id 'adapter_fwd' is not unique across all regions
[error 17] region_id 'IGVF_neuro_S1_R1_001.fastq.gz' is not unique across all regions
[error 18] region_id 'IGVF_neuro_S1_R3_001.fastq.gz' is not unique across all regions
[error 19] region_id 'adapter_rev' is not unique across all regions

Traceback (most recent call last):
  File "<frozen runpy>", line 198, in _run_module_as_main
  File "<frozen runpy>", line 88, in _run_code
  File "C:\Users\eugen\AppData\Local\Programs\Python\Python311\Scripts\seqspec.exe\__main__.py", line 7, in <module>
  File "C:\Users\eugen\AppData\Local\Programs\Python\Python311\Lib\site-packages\seqspec\main.py", line 68, in main
    COMMAND_TO_FUNCTION[sys.argv[1]](parser, args)
  File "C:\Users\eugen\AppData\Local\Programs\Python\Python311\Lib\site-packages\seqspec\seqspec_print.py", line 45, in validate_print_args
    print(s)
  File "C:\Users\eugen\AppData\Local\Programs\Python\Python311\Lib\encodings\cp1252.py", line 19, in encode
    return codecs.charmap_encode(input,self.errors,encoding_table)[0]
           ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
UnicodeEncodeError: 'charmap' codec can't encode characters in position 0-10: character maps to <undefined>