Giter VIP home page Giter VIP logo

unique379r / strspy Goto Github PK

View Code? Open in Web Editor NEW
15.0 4.0 5.0 35.65 MB

STRspy: a novel alignment and quantification-based state-of-the-art method, short tandem repeat (STR) detection calling tool designed specifically for long-read sequencing reads such as from Oxford nanopore technology (ONT) and PacBio.

License: MIT License

Shell 93.15% Python 4.70% R 2.16%
short-tandem-repeats str forensic-analysis foreniscs longread pacbio oxford-nanopore

strspy's Introduction

strspy

NEWS: We are pleased to announce that soon we are going to release STRspy 2.0. Stay tuned.

What you should expect in STRspy 2.0

1. DB_v2: Autosome and ChrY-specific STRs

2. New Utility script to generate DB from Genebank and Fasta.

3. New Interface of command line options

4. New Benchmarking results with multiple datasets

5. Docker container with the pre-installed tools to run the STRspy 2.0

STRspy: a novel alignment and quantification-based state-of-the-art method, short tandem repeat (STR) detection calling tool designed specifically for long-read sequencing reads such as from Oxford nanopore technology (ONT) and PacBio.

Cite

Hall CL, Kesharwani RK, Phillips NR, Planz JV, Sedlazeck FJ, Zascavage RR. Accurate profiling of forensic autosomal STRs using the Oxford Nanopore Technologies MinION device. Forensic Sci Int Genet. 2022 Jan;56:102629. doi: 10.1016/j.fsigen.2021.102629. Epub 2021 Nov 17. PMID: 34837788.

https://pubmed.ncbi.nlm.nih.gov/34837788/

Overview

DNA evidence has long been considered the gold standard for human identification in forensic investigations. Most often, DNA typing exploits the high variability of short tandem repeat (STR) sequences to differentiate between individuals at the genetic level. Comparison of STR profiles can be used for human identification in a wide range of forensic cases including homicides, sexual assaults, missing persons, and mass disaster victims. The number of contiguous repeat units present at a given microsatellite locus varies significantly among individuals and thus makes them useful for human identification purposes. Here, we are presents a complete pipeline i.e. STRspy to identify STRs in a long read sample i.e. Oxford nanopore sequencing reads and Pacbio reads.

Key Features

  1. Input either fastq (raw reads usually from ONT) or bam (pre-aligned reads usually from PacBio)
  2. Reports raw counts of allele along with their Normalized counts by their maximum value
  3. Find the top two significant Alleles (filtering threshold set by the user such as 0.4)
  4. Detects Small variants such as SNP and Indels
  5. Reports mapping summary and STR region of overlaps
  6. Stutters analysis for simple motifs of STRs

Installation

1.1 Install Miniconda

Download Miniconda installer from here: https://docs.conda.io/en/latest/miniconda.html and Install it to your laptop or server.

Conda under linux environment

wget https://repo.anaconda.com/miniconda/Miniconda3-py39_4.9.2-Linux-x86_64.sh

bash Miniconda3-py39_4.9.2-Linux-x86_64.sh

Follow the instructions directed by the miniconda script

1.2 Install STRspy

STRspy includes the installation of the following third-party software before it can be used.

gnu parallel >=20210222

samtools >=v1.12

bedtools >=v2.30.0

minimap2 >=v2.18-r1015

xatlas >=v0.2.1

Clone the repository

git clone [email protected]:unique379r/strspy.git

cd strspy

Create an environment

bash setup/STRspy_setup.sh

Activate the environment

conda activate strspy_env

Set up configuration

bash setup/MakeToolConfig.sh

mv UserToolsConfig.txt config/

deactivate the environment

conda deactivate

Quickstart

Modify the config files describing your data config/InputConfig.txt

Run STRspy

cd strspy

bash ./STRspy_run_v1.0.sh -h

USAGE: bash ./STRspy_run_v1.0.sh config/InputConfig.txt config/ToolsConfig.txt

Running with test datasets

The testset is provided testset.tar.gz with the package for the quick start, however, pre-computed results test_results.tar.gz are also available for reproducibility purposes. The test data should finish less than 12 Sec (via simple terminal use) to generate the results.

Extracting tar.gz Files

tar -xvf demodata/testset.tar.gz

Note: don't forget to change the config files & run the commands as instructed above

Compare your test results with pre-computed outputs here

tar -xvf demodata/test_results.tar.gz

InputConfig.txt

INPUT_DIR : A dir must have either fastq (Oxford nanopore genomic reads) or bam (aligned genomic reads such as from PacBio)

INPUT_BAM : Given inputs are bam or fastq (yes or no)

READ_TYPE : Sequencing Technology (ont or pb)

STR_FASTA : A dir contains Fasta files for each STR region of interest [assimung it has flanking regions (+/-) of 500bp]

STR_BED : A dir contains Bed files for each STR region of interest [assimung it has flanking regions (+/-) of 500bp]

GENOME_FASTA: Genome fasta (hg19/hg38) must provide in case of fastq input.

REGION_BED : All STr\R bed has to concatenate into a single bed file to calculate the coverage of it from the alignment sample file.

NORM_CUTOFF : A normalization threshold is required to select the top two allles of a STR

OUTPUT_DIR : A empty directory to write the results

ToolsConfig.txt

BEDTOOLS = ../user/path/bedtools

MINIMAP = ../user/path/minimap2

SAMTOOLS = ../user/path/samtools

XATLAS = ../user/path/xatlas

PARALLEL = ../user/path/parallel

Note

One may encounter a bug that using a wrapper (STRspy_run_v1.0.sh), STRspy parallel version may not be able to communicate properly with "gnu parallel" and exit the workflow without mapping or further steps of the analysis. The solution to this, the user may either run the script directly from scripts/STRspy_v1.0.sh in the STRspy dir or modify the STRspy_run_v1.0.sh script and allow the nested loop version of the workflow, but bear in mind that this is a little slower than the parallel version.

Evaluation

STRspy has been evaluated on 2 datasets including 30 cycles and 15 cycles of the ONT reads. Please have a look plots below for the benchmarking of the datasets we used. For more details please refer to our paper Hall CL, Kesharwani RK, Phillips NR, Planz JV, Sedlazeck FJ, Zascavage RR. Accurate profiling of forensic autosomal STRs using the Oxford Nanopore Technologies MinION device. Forensic Sci Int Genet. 2022 Jan;56:102629. doi: 10.1016/j.fsigen.2021.102629. Epub 2021 Nov 17. PMID: 34837788.

Heatmap of predicted STRs (30cycle and 15cycle)

References

Aaron R. Quinlan, Ira M. Hall, BEDTools: a flexible suite of utilities for comparing genomic features, Bioinformatics, Volume 26, Issue 6, 15 March 2010, Pages 841–842, https://doi.org/10.1093/bioinformatics/btq033

Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics, 34:3094-3100. https://doi:10.1093/bioinformatics/bty191

Heng Li, Bob Handsaker, Alec Wysoker, Tim Fennell, Jue Ruan, Nils Homer, Gabor Marth, Goncalo Abecasis, Richard Durbin, 1000 Genome Project Data Processing Subgroup, The Sequence Alignment/Map format and SAMtools, Bioinformatics, Volume 25, Issue 16, 15 August 2009, Pages 2078–2079, https://doi.org/10.1093/bioinformatics/btp352

Jesse Farek, Daniel Hughes, Adam Mansfield, Olga Krasheninina et al (2018). xAtlas: Scalable small variant calling across heterogeneous next-generation sequencing experiments. bioRxiv; doi: https://doi.org/10.1101/295071

O. Tange (2018): GNU Parallel 2018, March 2018, https://doi.org/10.5281/zenodo.1146014.

Contacts

bioinforupesh200 DOT au AT gmail DOT com

rupesh DOT kesharwani AT bcm DOT edu

strspy's People

Contributors

unique379r avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar  avatar  avatar

strspy's Issues

Issue about installation

Hi there,

I was trying to install this tool as follow:

git clone [email protected]:unique379r/strspy.git
cd strspy
bash setup/STRspy_setup.sh

However, I got the following error:

                                #### Welcome to the installation of third-party software for STRspy pipeline use ####
                                                        #### Before to Run this script ####


#Make sure internet connection works properly in your privileges.
# bash ./STRspy_setup.sh
Continue? (y/n) : y
checking if strspy_env is already present....


#conda appears to have already installed !
#attempting to make a conda env and install required packages..

EnvironmentFileNotFound: '/nfs/turbo/bin/strspy/environment.yml' file not found

#Installation may done, please verify it by restarting your terminal and --> conda info --envs | grep ^strspy_env | awk '{print }'

I did not see the environment.yml under strspy which was cloned from your repo.

Any advice on this matter would be appreciated.

Best,
Hsin

README problem

in readme,mv UserToolsConfig.txt config/ should be mv UserToolsConfig.txt config/ToolsConfig.txt?

Primary alignment filtering

Hi,

I've found a way to reduce background repeat counts.

In line 333 of https://github.com/unique379r/strspy/blob/main/scripts/STRspy_v1.0.sh reads are filtered so that only unmapped are eliminated from repeat counting.

If swapped to keep only primary alignments (-F 2308) instead of -F 4 which also keeps secondary and supplementary alignments, this leads to much tidier repeat counting and reduced background repeat counts.

I propose changing filtering from -F 4 to -F 2308.

Thank you.

Y database

Hi,

I am trying to create the Y-database, but I have not been able to do so.

From the README in the Y-str-prep folder:

  • What should be in the < input motif repeats > file?
  • Do I use v5 for single repeats and v4 for batch lists of repeats?

Autosomal worked great :)

Best,
Martin

General questions and Error: inconsistent naming convention

Hi Rupesh,

I have several questions about the usage:

  1. I am wondering whether there are any limitations on its detection length.
  2. Could I use strspy to detect the repeat sequence CCCCGCGCCCGGCCTTCCCCGGGGTCCCTGCGGCCCCGACTGTGCGCC profile?
  3. How do I use strspy to quantify the number of contiguous repeat units? I did not see a direct result from the output, or I might have missed this information.

Besides, when running strspy, I got this error:

***** WARNING: File /scratch/kinfai_root/kinfai0/hsinlun/tri_test/align/C9ORF72_1_9R_NanoSim_2x.sorted.bam has inconsistent naming convention for record:
chr1	14337	20040	C9ORF72-1_14451_aligned_12683_F_19_5702_13	0	+

***** WARNING: File /scratch/kinfai_root/kinfai0/hsinlun/tri_test/align/C9ORF72_1_9R_NanoSim_2x.sorted.bam has inconsistent naming convention for record:
chr1	14337	20040	C9ORF72-1_14451_aligned_12683_F_19_5702_13	0	+

I would appreciate any solutions to this.

Best,
Hsin

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.