timflutre / trimmomatic Goto Github PK

Hi,

I wanted to implement something like a "tail-crop trimmer" in trimmomatic terminology, but got a bit confused by the available ones. It seems to me that the actual head-crop trimmer does not do what the documentaiton states. While the manual states:

"HEADCROP: Cut the specified number of bases from the start of the read"

line 22 in HeadCropTrimmer.java

" return new FastqRecord(in,pos,len-pos);"

implies that the bases are removed from both ends of the read.

Could you please comment on this one?

Best regards,

Pavlo

Hi All, I am a newcomer in bioinformatics. recently I use the trimmomatic to train myself. First, I install the trimmomatic by conda, which means I can execute by command line "trimmomatic PE -threads 4 -phred 33........(as the standard protocol)", it might work but please see below some errors happened: my question are: 1. why cannot find the TruSeq3-PE.fa? I found the file in ~/miniconda3/pkgs/trimmomatic-0.38-1/share/trimmomatic-0.38-1/adapters. 2. and the other java problems as shown.
error:
trimmomatic PE -phred33 SRR4449813_1_1.fastq SRR4449813_1_2.fastq paired_1_R1_paired.fq.gz unpaired_1_R1_unpaired.fq.gz paired_1_R2_paired.fq.gz unpaired_1_R2_unpaired.fq.gz ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:3 TrimmomaticPE: Started with arguments: -phred33 SRR4449813_1_1.fastq SRR4449813_1_2.fastq paired_1_R1_paired.fq.gz unpaired_1_R1_unpaired.fq.gz paired_1_R2_paired.fq.gz unpaired_1_R2_unpaired.fq.gz ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:3 Multiple cores found: Using 4 threads java.io.FileNotFoundException: /home/decen/下载/srr/TruSeq3-PE.fa (No such file or directory)
at java.io.FileInputStream.open0(Native Method)
at java.io.FileInputStream.open(FileInputStream.java:195)
at java.io.FileInputStream.(FileInputStream.java:138)
at org.usadellab.trimmomatic.fasta.FastaParser.parse(FastaParser.java:54)
at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.loadSequences(IlluminaClippingTrimmer.java:110)
at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.makeIlluminaClippingTrimmer(IlluminaClippingTrimmer.java:71)
at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:32)
at org.usadellab.trimmomatic.Trimmomatic.createTrimmers(Trimmomatic.java:59)
at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:552)
at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:80)
Input Read Pairs: 3438238 Both Surviving: 3397549 (98.82%) Forward Only Surviving: 37731 (1.10%) Reverse Only Surviving: 2828 (0.08%) Dropped: 130 (0.00%) TrimmomaticPE: Completed successfully

Thanks a lot!

Hi @timflutre
Hope you are fine and keeping safe
I am running kneaddata, but it gave and error with Trimmomatic
**kneaddata –input1 /media/sf_Shared_folder/ovas/Final/81_R1.fastq --input2 /media/sf_Shared_folder/ovas/Final/81_R2.fastq --reference-db /home/qiime2/ref_dtabase/ --output kneaddata_81 --trimmomatic /home/qiime2/Trimmomatic-0.33
Reformatting file sequence identifiers …

Reformatting file sequence identifiers …

Reordering read identifiers …

Initial number of reads ( /home/qiime2/kneaddata_81/reordered_qhik9bbx_reformatted_identifierse3uxy95f_81_R1 ): 22625162.0
Initial number of reads ( /home/qiime2/kneaddata_81/reordered_enctz3x3_reformatted_identifiersd8ic66o3_81_R2 ): 22625162.0
Running Trimmomatic …
CRITICAL ERROR: Error executing: java -Xmx500m -jar /home/qiime2/Trimmomatic-0.33/trimmomatic-0.33.jar PE -threads 1 -phred33 /home/qiime2/kneaddata_81/reordered_qhik9bbx_reformatted_identifierse3uxy95f_81_R1 /home/qiime2/kneaddata_81/reordered_enctz3x3_reformatted_identifiersd8ic66o3_81_R2 /home/qiime2/kneaddata_81/81_R1_kneaddata.trimmed.1.fastq /home/qiime2/kneaddata_81/81_R1_kneaddata.trimmed.single.1.fastq /home/qiime2/kneaddata_81/81_R1_kneaddata.trimmed.2.fastq /home/qiime2/kneaddata_81/81_R1_kneaddata.trimmed.single.2.fastq MINLEN:60 ILLUMINACLIP:/home/qiime2/miniconda/envs/kneaddata/lib/python3.8/site-packages/kneaddata/adapters/NexteraPE-PE.fa:2:30:10:8:TRUE SLIDINGWINDOW:4:20 MINLEN:75

Error message returned from Trimmomatic :
<JAVA_HOME>/lib/ext exists, extensions mechanism no longer supported; Use -classpath instead.
.Error: Could not create the Java Virtual Machine.
Error: A fatal exception has occurred. Program will exit**
I posted not biobakery forum, but didn't got any response yet can understand the time constraints and busy schedule of every one there).
Kindly guide how to overcome this issue.

I developed a trivial test dataset to test the clipping capacity of trimmomatic with perfectly sequenced adapters (no mismatches). My read files are as follows:

fastq 1 (forward read)

5'ADAPTERfoo
bar
5'ADAPTERbaz

fastq 2 (reverse read)

foo
3'REVCOMPLEMENTADAPTERbar
3'REVCOMPLEMENTADAPTERbaz

The behavior I am observing seems to be associated with the Simple clipping mode on paired-end data. Palindromic mode is not engaged in this circumstance. I was troubled to find that when contamination is in one read only, the whole read is dropped. This behavior is documented in the manual.

However, this is not desired behavior in nearly all circumstances. For example, consider the behavior of cutadapt, which clips the adapter-matching sequences when they are identified. In a very typical 2x100bp run, Trimmomatic will completely drop both reads if contamination is found at both the 5` and 3' end. It will also drop a read if the whole adapter sequence is found in it. This is clearly not "clipping" the adapters from the reads.

>java -jar ~/Projects/external_packages/Trimmomatic-0.32/trimmomatic-0.32.jar PE -threads 80 -phred33 -trimlog trimmoatic.log test1.fastq test2.fastq example1.fastq example1.unpaired.fastq example2.fastq example2.unpaired.fastq ILLUMINACLIP:adapters.fa:1:20:20:12:true MINLEN:20
TrimmomaticPE: Started with arguments: -threads 80 -phred33 -trimlog trimmoatic.log test1.fastq test2.fastq example1.fastq example1.unpaired.fastq example2.fastq example2.unpaired.fastq ILLUMINACLIP:adapters.fa:1:20:20:12:true MINLEN:20
Using PrefixPair: 'TTACTATTTTTAAACCTAGAACGCAGGATATAAC' and 'AGATAAAAATACCTCGCGCGGTTGACCCCGTAGG'
Using Long Clipping Sequence: 'CCTACGGGGTCAACCGCGCGAGGTATTTTTATCT'
Using Long Clipping Sequence: 'TTACTATTTTTAAACCTAGAACGCAGGATATAAC'
Using Long Clipping Sequence: 'AGATAAAAATACCTCGCGCGGTTGACCCCGTAGG'
Using Long Clipping Sequence: 'GTTATATCCTGCGTTCTAGGTTTAAAAATAGTAA'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 2 Both Surviving: 0 (0.00%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 1 (50.00%) Dropped: 1 (50.00%)
TrimmomaticPE: Completed successfully

adapters.fa

>PrefixPE/1
TTACTATTTTTAAACCTAGAACGCAGGATATAAC
>PrefixPE/2
AGATAAAAATACCTCGCGCGGTTGACCCCGTAGG
>PE1
TTACTATTTTTAAACCTAGAACGCAGGATATAAC
>PE1_rc
GTTATATCCTGCGTTCTAGGTTTAAAAATAGTAA
>PE2
AGATAAAAATACCTCGCGCGGTTGACCCCGTAGG
>PE2_rc
CCTACGGGGTCAACCGCGCGAGGTATTTTTATCT

test1.fastq

@A2RC-4
CCTACGGGGTCAACCGCGCGAGGTATTTTTATCTCAATTGGTTTTTTTCCTCCGGTATGGAAGCCCCCAATGGTTGCATACTACCGACTCGTCCTTATGA
+
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
@A2RC-5
CCTACGGGGTCAACCGCGCGAGGTATTTTTATCTCAATTGGTTTTTTTCCTCCGGTATGGAAGCCCCCAATGGTTGCATACTACCGACTCGTCCTTATGA
+
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG

test2.fastq

@A2RC-4
ACATTTTAGCGCCGGGTCGGGTGTGATAGAGTTTATGTCACCAATGCGTTTGGCTCTTGGAGATAGTCTTCATAAGGATTTGTAAGTAGACCAGATCACA
+
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
@A2RC-5
TTACTATTTTTAAACCTAGAACGCAGGATATAACCACTTGTATGGACTGAACAGATCGAAATGCACTCCCGGCGGATTATCTGGAAGTCTGCGGAGAGAC
+
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG

Hi,

Trying to compile the 0.33 but fails with a following;

javac: file not found: /org/usadellab/trimmomatic/fasta/FastaParser.java

But FastaParser.java is there in the right path.

My Mac:
ProductName: Mac OS X
ProductVersion: 10.10.3
BuildVersion: 14D131

Java -version:
java version "1.8.0_25"
Java(TM) SE Runtime Environment (build 1.8.0_25-b17)
Java HotSpot(TM) 64-Bit Server VM (build 25.25-b02, mixed mode)

Thanks.

Thank you for your good job on trimmomatic, which helps us a lot.
We now run into some trouble of high Memory use. How do you think about this ?

Hello!

Is it possible to trim the customed adaptors using trimmomatic for exon capture sequencing?
If so, how can I create the adaptor fasta file (sequence header etc.)?

The adapters used are below, "BCBCBCBC" stands for the barcodes.

i7: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-BCBCBCBC-ATCTCGTATGCCGTCTTCTGCTTG

i5: AATGATACGGCGACCACCGAGATCTACAC-BCBCBCBC-ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Thank you in advance
Best
Ruiqi

I have bisulfite sequencing reads for 6 samples. At first I used fastQC to check the quality of the reads. I found lots of Illumina universal adapters in my reads. Then I used trimmomatic paired-end to trim these overrepresented sequences. After trimming with the trimmomatic, the quality of the forward reads improved but reverse reads still are terrible. Actually, there were overrepresented sequences in both forward and reverse reads before trimming. After trimming, the forward reads do not have those over-represented sequences, but the reverse reads still have them.

java -jar trimmomatic-0.39.jar PE -threads 12 PV6N-3_S35_L004_R1_001.fastq.gz PV6N-3_S35_L004_R2_001.fastq.gz pv6n_3_output_forward_paired3.fq.gz pv6n_3_output_forward_unpaired3.fq.gz pv6n_3_output_reverse_paired3.fq.gz pv6n_3_output_reverse_unpaired3.fq.gz ILLUMINACLIP:sequence_adaptors.fasta:2:30:10:2:keepBothReads

This is my command. Almost 20 percents of the reverse reads contain over-represented sequences.

Hi, can someone please tell me how I install Trimmomatic? The documentation I'm reading isn't very straight forward for the non bioinformatican! Ive popped the folder in my home directory but don't understand what I'm making when using the make command on the screenshot!

Cheers

Hi,
I'm running the following and getting empty outputs:
java -jar /home/madzays/bin/trimmomatic.jar PE -phred33 /home/madzays/data/finch_data/firstrun/test/RSFV1M_S47_L006_R1_001.fastq /ho me/madzays/data/finch_data/firstrun/test/RSFV1M_S47_L006_R2_001.fastq ./RSFV1M_S47_L006_R1_001_paired.fastq ./RSFV1M_S47_L006_R1_001_unpaired.fastq ./RSFV1M_S47_L006_R2_001_paired.fastq ./RSFV1M_S47_L006_R2_001_unpaired.fastq SLIDINGWINDOW:4:25 MINLEN:36
TrimmomaticPE: Started with arguments: -phred33 /home/madzays/data/finch_data/firstrun/test/RSFV1M_S47_L006_R1_001.fastq /home/madzays/data/finch_data/firstrun/test/RSFV1M_S47_L006_R2_001.fastq ./RSFV1M_S47_L006_R1_001_paired.fastq ./RSFV1M_S47_L006_R1_001_unpaired.fastq ./RSFV1M_S47_L006_R2_001_paired.fastq ./RSFV1M_S47_L006_R2_001_unpaired.fastq SLIDINGWINDOW:4:25 MINLEN:36
Multiple cores found: Using 16 threads
Input Read Pairs: 0 Both Surviving: 0 (�%) Forward Only Surviving: 0 (�%) Reverse Only Surviving: 0 (�%) Dropped: 0 (�%)
TrimmomaticPE: Completed successfully
Any ideas what I might be going wrong?
Thank you!
-madza farias-virgens

The webpage http://www.usadellab.org/cms/index.php?page=trimmomatic that provides the manual has disappeared.
Indeed, the whole domain has disappeared. Could the manual be put onto github?

I'm running Trimmomatic 0.36 in a machine with 12 cores, but the program uses only one core.
See my command line below:
java -jar trimmomatic-0.36.jar SE -phred64 todos_um.fastq todos_um_phred05.fastq SLIDINGWINDOW:4:15 LEADING:3 TRAILING:3 MINLEN:36 -threads 12 -trimlog trimLogFile.txt

It would be nice to see it published somewhere in bintray or sonatype

Hello,

Kindly, I have a question regarding trimmomatic primer trimming:

I work on data generated via enrichment-based NGS. Therefore, I have custom-designed primers. My question is how to trim these primers like the illuminaClip?

Thank you,

Regards,

--Hi,

i have strange behaviour on my cluster node using trimmomatic regarding the use of multiple threads:

this is the command line i use:

java -XX:ParallelGCThreads=4 -XX:+DoEscapeAnalysis -Xmx8g -jar $prog/trimmomatic-0.36.jar PE -threads 16 -phred33 $IN_OUT/ERR532589_1.fastq.gz $IN_OUT/ERR532589_2.fastq.gz $IN_OUT/Out_ERR532589_1.fastq.gz $IN_OUT/Out_unpaired_ERR532589_1.fastq.gz $IN_OUT/Out_ERR532589_2.fastq.gz $IN_OUT/Out_unpaired_ERR532589_2.fastq.gz ILLUMINACLIP:$ADAPTERS/TruSeq3-PE-2.fa:2:40:15:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

it was mentionned that i use 16 threads but in the log file of my LSF job i see only 4 processes:

Resource usage summary:

CPU time :               20157.96 sec.
Max Memory :             3544 MB
Average Memory :         2677.95 MB
Total Requested Memory : 124800.00 MB
Delta Memory :           121256.00 MB
(Delta: the difference between Total Requested Memory and Max Memory.)
Max Processes :          4
Max Threads :            51

What is the best way to optimize my command line, it seems that if i put 4,6..or 16 theads the behaviour and the elapsed time still the same.

I work on node with 2 CPU (8 core each) and 128GB per node

thank you,
Laurent --

Hi@abmiguez
in hope you are fine,
I am trying to install biobakery an i am getting this error
tried my ways but failed.followed some tutorials and guides also
kindly help and mention the command I will be running in my case
like you did it here
#
Problem 1
biobakery_workflows_databases --install wmgx
Installing humann utility mapping database
Download URL: http://huttenhower.sph.harvard.edu/humann2_data/full_mapping_v201901.tar.gz
Downloading file of size: 2.55 GB

2.55 GB 100.00 % 1.49 MB/sec 0 min -0 sec
Extracting: /home/qiime2/biobakery_workflows_databases/humann/full_mapping_v201901.tar.gz

Database installed: /home/qiime2/biobakery_workflows_databases/humann/utility_mapping

HUMAnN configuration file updated: database_folders : utility_mapping = /home/qiime2/biobakery_workflows_databases/humann/utility_mapping
Generating strainphlan fasta database
Could not locate a Bowtie index corresponding to basename "/home/qiime2/miniconda/envs/kneaddata/lib/python3.8/site-packages/metaphlan/metaphlan_databases/mpa_v30_CHOCOPhlAn_201901"
Error: Encountered internal Bowtie 2 exception (#1)
Command: /home/qiime2/miniconda/envs/abmiguez kneaddata/bin/bowtie2-inspect-s --wrapper basic-0 /home/qiime2/miniconda/envs/kneaddata/lib/python3.8/site-packages/metaphlan/metaphlan_databases/mpa_v30_CHOCOPhlAn_201901
Unable to install database. Error running command: bowtie2-inspect /home/qiime2/miniconda/envs/kneaddata/lib/python3.8/site-packages/metaphlan/metaphlan_databases/mpa_v30_CHOCOPhlAn_201901 > /home/qiime2/biobakery_workflows_databases/strainphlan_db_markers/all_markers.fasta

Problem 2
And secondly If hopefully I am done with installation, please let me know the tutorial I will following for analysis my shotgun datsets

hi ,

I am new to this . I am Trimmomatic on human sample and i am getting error of FILE size is too large .

Terminal scree shot ----

java -Xmx128g -jar trimmomatic-0.36.jar PE -threads 6 -phred33 /media/haroon/DKVL_3.19/amit_raw_files/RHH031_1.fastq.gz /media/haroon/DKVL_3.19/amit_raw_files/RHH031_2.fastq.gz -baseout Trimmed/RHH031 TRAILING:30
TrimmomaticPE: Started with arguments:
-threads 6 -phred33 /media/haroon/DKVL_3.19/amit_raw_files/RHH031_1.fastq.gz /media/haroon/DKVL_3.19/amit_raw_files/RHH031_2.fastq.gz -baseout Trimmed/RHH031 TRAILING:30
Using templated Output files: Trimmed/RHH031_1P Trimmed/RHH031_1U Trimmed/RHH031_2P Trimmed/RHH031_2U
java.io.IOException: File too large
at java.io.FileOutputStream.writeBytes(Native Method)
at java.io.FileOutputStream.write(FileOutputStream.java:326)
at sun.nio.cs.StreamEncoder.writeBytes(StreamEncoder.java:221)
at sun.nio.cs.StreamEncoder.implWrite(StreamEncoder.java:282)
at sun.nio.cs.StreamEncoder.write(StreamEncoder.java:125)
at java.io.OutputStreamWriter.write(OutputStreamWriter.java:207)
at java.io.BufferedWriter.flushBuffer(BufferedWriter.java:129)
at java.io.BufferedWriter.write(BufferedWriter.java:230)
at java.io.Writer.write(Writer.java:157)
at org.usadellab.trimmomatic.fastq.FastqSerializer.writeRecord(FastqSerializer.java:63)
at org.usadellab.trimmomatic.threading.SerializerWorker.run(SerializerWorker.java:45)
at java.lang.Thread.run(Thread.java:748)
Exception in thread "Thread-2" java.lang.RuntimeException: java.io.IOException: File too large
at org.usadellab.trimmomatic.threading.SerializerWorker.run(SerializerWorker.java:56)
at java.lang.Thread.run(Thread.java:748)
Caused by: java.io.IOException: File too large
at java.io.FileOutputStream.writeBytes(Native Method)
at java.io.FileOutputStream.write(FileOutputStream.java:326)
at sun.nio.cs.StreamEncoder.writeBytes(StreamEncoder.java:221)
at sun.nio.cs.StreamEncoder.implWrite(StreamEncoder.java:282)
at sun.nio.cs.StreamEncoder.write(StreamEncoder.java:125)
at java.io.OutputStreamWriter.write(OutputStreamWriter.java:207)
at java.io.BufferedWriter.flushBuffer(BufferedWriter.java:129)
at java.io.BufferedWriter.write(BufferedWriter.java:230)
at java.io.Writer.write(Writer.java:157)
at org.usadellab.trimmomatic.fastq.FastqSerializer.writeRecord(FastqSerializer.java:63)
at org.usadellab.trimmomatic.threading.SerializerWorker.run(SerializerWorker.java:45)
... 1 more
java.io.IOException: File too large

please help to resolve this issues.

Thanks and regards

I am processing in Paired End Mode, having specified the [-trimlog ] this is the error message I am getting:

Exception in thread "main" java.lang.RuntimeException: Unknown trimmer: /home/venkat/Desktop/output_reverse_unpaired.fq.gz
at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:70)
at org.usadellab.trimmomatic.Trimmomatic.createTrimmers(Trimmomatic.java:59)
at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:536)
at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:80)

The main page of the project on github does not have a license that GitHub can recognize. I think it wants the license to exist in the root folder. I see there's a GPL V3+ license at distSrc/License. I can provide a pull request if that's helpful to add that license to the root.

Trimmomatic 0.38 is not able to detect whether my reads are phred33 or phred64 quality encoded. Does this mean that my fastq files contain errors or is it a bug in Trimmomatic? Thanks for your help.

TrimmomaticPE: Started with arguments:
 -threads 10 -trimlog trimmomatic.log R1.fq.gzR2.fq.gz R1.trimmomatic.fq.gz R1.trimmomatic.unpaired.fq.gz R2.trimmomatic.fq.gz R2.trimmomatic.unpaired.fq.gz LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:50 ILLUMINACLIP:Trimmomatic-0.38/adapters/TruSeq4-PE.fa:2:30:10

Using Long Clipping Sequence: 'GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG'
Skipping duplicate Clipping Sequence: 'ACACTCTTTCCCTACACGACGCTCTTCCGATCT'
Skipping duplicate Clipping Sequence: 'TGGAATTCTCGGGTGCCAAGG'
Using Long Clipping Sequence: 'CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTC'
Skipping duplicate Clipping Sequence: 'ACACTCTTTCCCTACACGACGCTCTTCCGATCT'
Using Long Clipping Sequence: 'CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTC'
Using Long Clipping Sequence: 'CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTC'
Using Short Clipping Sequence: 'ATGGAATTCTCG'
Skipping duplicate Clipping Sequence: 'GTTCAGAGTTCTACAGTCCGACGATC'
Skipping duplicate Clipping Sequence: 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT'
ILLUMINACLIP: Using 0 prefix pairs, 52 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Error: Unable to detect quality encoding

Hey,
Your tutorial web page looks down,

Cheers,
Luis Alfonso.