Giter VIP home page Giter VIP logo

goalign's Introduction

Goalign

build Anaconda-Server Badge Docker hub downloads DOI:10.1093/nargab/lqab075

Goalign Logo

Goalign is a set of command line tools to manipulate multiple alignments. It is implemented in Go language.

Goalign aims to handle multiple alignments in Phylip, Fasta, Nexus, and Clustal formats, through several basic commands. Each command may print result (an alignment for example) in the standard output, and thus can be piped to the standard input of the next goalign command.

Input files may be local or remote files:

  • If file name is of the form http(s)://<URL>, the file is download from the given URL.
  • Otherwise, the file is considered local.

Gzipped input files (.gz extension) are supported, as well as XZ files (.xz extension) and BZipped files (.bz[2] extension).

Note:

TO manipulate phylogenetic trees, See also Gotree.

Reference

If you use Gotree or Goalign, please cite:

Frédéric Lemoine, Olivier Gascuel

Gotree/Goalign: toolkit and Go API to facilitate the development of phylogenetic workflows,

NAR Genomics and Bioinformatics, Volume 3, Issue 3, September 2021, lqab075, doi

Installation

Easy way: Binaries

You can download ready to run binaries for the latest release in the release section. Binaries are available for MacOS, Linux, and Windows (32 and 64 bits).

Once downloaded, you can just run the executable without any other downloads.

Docker

Goalign Docker image is accessible from docker hub. You may use it as following:

# Display goalign help
docker run -v $PWD:$PWD -w $PWD -i -t evolbioinfo/goalign:v0.2.6 -h

Singularity

Goalign docker image is usable from singularity . You may use it as following:

# Pull image from docker hub
singularity pull docker://evolbioinfo/goalign:v0.2.6
# Display goalign help
./goalign-v0.2.6.simg -h

Conda

Goalign is also available on bioconda. Just type:

conda install -c bioconda goalign

From sources

To build goalign, you must first download and install Go on your system ($1.21.6$).

Then you just have to type :

git clone [email protected]:evolbioinfo/goalign.git
cd goalign
make && make install
# or go get . && go build .
# or go get . && go install .

The goalign executable should be located in the current folder (or the $GOPATH/bin).

To test the executable:

./test.sh

Auto completion

goalign uses cobra, and therefore proposes a command to generate auto completion scripts:

gotree completion -h

Usage

You may go to the doc for a more detailed documentation of the commands.

List of commands

  • addid: Adds a string to each sequence identifier of the input alignment
  • append: Concatenates several alignments by adding new alignments as new sequences of the first alignment
  • build: Command to build output files : bootstrap for example
    • seqboot : Generate bootstrap alignments
  • clean: Removes gap sites/sequences
    • sites : Removes sites with gaps
    • seqs : Removes sequences with gaps
  • codonalign: Aligns a given nt fasta file using a corresponding aa alignment (by codons)
  • compress: Removes identical patterns/sites from alignment
  • compute: Different computations (distances, etc.)
    • distances: compute evolutionary distances for nucleotide alignment
    • entropy: compute entropy of alignment sites
    • pssm: compute position-specific scoring matrix
  • concat: Concatenates several alignments by concatenating each sequences having the same name
  • consensus: Compute a basic majority consensus of an input alignment
  • dedup: Remove sequences that have the same sequence
  • diff : Compare all sequences to the first one of the alignment, and count the differences
  • divide: Divide an input alignment in several output files (one per alignment)
  • draw: Draw alignments
    • biojs: Display an input alignment in an html file using BioJS
    • png: Display an input alignment in a png file, one sequence per line and one pixel per character
  • extract: Extract several sub-alignments, potentially composed of several blocks, from an input alignment, using an coordinate file
  • identical: Tell whether two alignments are identical
  • mask: Replace positions by N (of nucleotides) or X (if amino-acids)
  • mutate: Add substitutions (~sequencing errors), or gaps, uniformly in an input alignment
    • gaps: Add gaps uniformly in an input alignment
    • snvs: Add substitutions uniformly in an input alignment
  • orf: Find the longest orf in all given sequences in forward strand
  • phase: Try to find reference orf(s) (aa) in input sequences, and align it on the same phase
  • phasent: Try to find reference sequence (nt) in input sequences, and align it on the same phase
  • random: Generate random sequences
  • reformat: Reformats input alignment into several formats
    • fasta
    • nexus
    • paml
    • clustal
    • phylip
    • tnt
  • rename: Rename sequences of the input alignment, (using a map file, with a regexp, or just clean names)
  • replace: Replace characters in sequences of input alignment using a regex
  • sample: Samples sequences or subalignments
    • seqs: Randomly samples a subset of sequences from the input alignment
    • sites: Extracts a sub-alignment starting a a random position, and with a given length
    • rarefy: Down-samples input alignment, taking into accounts weights/counts of all sequences
  • shuffle: A set of commands to shuffle an alignment
    • recomb: Recombine some sequences (copy/paste)
    • rogue: simulate sort of rogue taxa by shuffling some sequences
    • seqs: Shuffle sequence order in the alignment
    • sites: Shuffle "vertically" some sites of the alignments
    • swap: Swap portions of some sequences (cut/paste)
  • split: Split an input alignment according to partitions defined in a partition file
  • stats: Prints different characteristics of the alignment
    • alleles
    • alphabet
    • char
    • gaps
    • length
    • mutations
    • nalign
    • nseq
    • taxa
  • subseq: Extract a subsequence from the alignment (coordinates on alignment reference or on a given sequence reference)
  • subsites: Extract sites from the input alignment (coordinates on alignment reference or on a given sequence reference, or informative sites)
  • subset: Take a subset of sequences from the input alignment
  • sw: Aligns 2 sequences using Smith & Waterman algorithm
  • translate: Translate input sequences/alignment (supports IUPAC code)
  • transpose: Transpose input alignment
  • trim: This command trims names of sequences or sequences themselves
    • name
    • seq
  • unalign: Unaligns input alignment
  • version: Prints the current version of goalign

Goalign commandline examples

  • Generate a random alignemnt and print statistics
goalign random | goalign stats
  • Trim names of a random alignment and finally rename it back
goalign random > align.fa
goalign trim name -n 3 -m map -i align.fa > align_rename.fa
goalign rename -i align_rename.fa -m map -r 
  • Reformat a fasta alignment to phylip
goalign random | goalign reformat phylip
  • Reformat a clustal alignment to fasta
goalign random --amino-acids --clustal --nb-seqs 2 | goalign reformat fasta --clustal
  • Reformat a phylip alignment to fasta
goalign random -p | goalign reformat fasta -p
  • Add a prefix to all sequence names of the alignment
goalign random  | goalign addid -n "Dataset1_" 
  • Add a suffix to all sequence names of the alignment
goalign random  | goalign addid -r -n "_Dataset1" 
  • Take a random sample (10 sequences) from an input alignment
goalign random -n 10000 | goalign sample -n 10
  • Extract all sequences whose name starts with "mammal"
goalign subset -e '^mammal.*$' -i align.fasta
  • Extract all sequences whose name does match the regexp
goalign subset -r -e '^mammal.*$' -i align.fasta
  • Extract a sub sequences going from position 10 and with a length of 100
goalign subseq -i align.fasta -s 9 -l 10
  • Compute a "logo" like consensus
goalign compute pssm -n 4 -i align.fasta
  • Compute an evolutionary distance matrix (dna alignment only, 5 threads)
goalign compute distance -m k2p -i align.fasta -t 5
  • Compute site entropry
goalign compute entropy -i align.fasta
  • Build 100 bootstrap alignments from an input alignment, in a single tar.gz file (5 threads)
goalign random -n 500 | goalign build seqboot -S -n 100 --gz --tar -t 5 -o boot
  • Build 100 bootstrap alignments from an input alignment, in 100 .gz files (5 threads)
goalign random -n 500 | goalign build seqboot -S -n 100 --gz -t 5 -o boot

Goalign api usage examples

  • Parse a Phylip single alignment file and export it in Fasta
package main

import (
	"fmt"
	"os"

	"github.com/evolbioinfo/goalign/align"
	"github.com/evolbioinfo/goalign/io/fasta"
	"github.com/evolbioinfo/goalign/io/phylip"
)

func main() {
	var err error
	var f *os.File
	var align align.Alignment

	f, err = os.Open("f.phy")
	if err != nil {
		panic(err)
	}
	if align, err = phylip.NewParser(f).Parse(); err != nil {
		panic(err)
	} else {
		fmt.Println(fasta.WriteSequences(align))
	}
}
  • Parse a Phylip multi alignments file and export it in Fasta
package main

import (
	"fmt"
	"os"

	"github.com/evolbioinfo/goalign/align"
	"github.com/evolbioinfo/goalign/io/fasta"
	"github.com/evolbioinfo/goalign/io/phylip"
)

func main() {
	var f *os.File
	var aligns chan align.Alignment
	var err error

	f, err = os.Open("f.phy")
	if err != nil {
		panic(err)
	}
	aligns = make(chan align.Alignment, 15)
	if err = phylip.NewParser(f).ParseMultiple(aligns); err != nil {
		panic(err)
	} else {
		for al := range aligns {
			fmt.Println(fasta.WriteSequences(al))
		}
	}
}
  • Parse a Fasta file and export it in Nexus
package main

import (
	"fmt"
	"os"

	"github.com/evolbioinfo/goalign/align"
	"github.com/evolbioinfo/goalign/io/fasta"
	"github.com/evolbioinfo/goalign/io/nexus"
)

func main() {
	var f *os.File
	var align align.Alignment
	var err error

	f, err = os.Open("f.fasta")
	if err != nil {
		panic(err)
	}
	if align, err = fasta.NewParser(f).Parse(); err != nil {
		panic(err)
	} else {
		fmt.Println(nexus.WriteAlignment(align))
	}
}
  • Parse a Fasta file and export it in Phylip
package main

import (
	"fmt"
	"os"

	"github.com/evolbioinfo/goalign/align"
	"github.com/evolbioinfo/goalign/io/fasta"
	"github.com/evolbioinfo/goalign/io/phylip"
)

func main() {
	var f *os.File
	var align align.Alignment
	var err error

	f, err = os.Open("f.fasta")
	if err != nil {
		panic(err)
	}
	if align, err = fasta.NewParser(f).Parse(); err != nil {
		panic(err)
	} else {
		fmt.Println(phylip.WriteAlignment(align, false))
	}
}
  • Iterating over alignment sequences
	align.IterateChar(func(name string, sequence []uint8) {
		fmt.Printf("Sequence: %s\n", name)
	})
  • Append identifier at the beginning of all sequence names
align.AppendSeqIdentifier("IDENT", false)
  • Alignment statistics
var n int = align.NbSequences()
var l int = align.Length()
  • Extract a sub alignment
var subalign align.Alignment
var err error
subalign,err = align.SubAlign(0, 100)
  • Sort sequences by alphanumerical order
align.Sort()
  • Copy/Clone the alignment
var clonealign align.Alignment
var err error
clonealign,err = align.Clone()
  • Get the sequence having a specific name
var sequence string
var err error
sequence,err = align.GetSequence("nameofsequence")
  • Build a bootstrap replicate
var bootstrap align.Alignment
bootstrap = align.BuildBootstrap()
  • Randomly shuffle sequence order of alignment
align.ShuffleSequences()
  • Compute evolutionary ditance matrix (5 threads)
import "github.com/evolbioinfo/goalign/distance"
//...
var model distance.DistModel
var distMatrix [][]float64
model = distance.Model("k2p", false)
distmatrix = distance.DistMatrix(align, nil, model, 5)
  • Other functions

Other functions are described in the godoc.

goalign's People

Contributors

fredericlemoine avatar lucblassel avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

goalign's Issues

`gotree version` produces empty output

Hello.

When running:

gotree version

I get a blank line instead of the version number.

I am running version 0.4.3 installed via conda.

It is also blank when running --help:

gotree --help
gotree is a set of tools to handle phylogenetic trees in go.

Different usages are implemented: 
- Generating random trees
- Transforming trees (renaming tips, pruning/removing tips)
- Comparing trees (computing bootstrap supports, counting common edges)

Version: 

Usage:
  gotree [flags]
  gotree [command]

Option to filter sites/columns in alignment based on percentage of identity

Thanks for developing this great alignment processing tool.
I would be very interested if you could add an option that would allow to filter sites/columns in an alignment based on conservation across all sequences in the alignment (percentage of identity, eg ).
This would be very helpful for constructing "relaxed" core variants from multiple genomes alignment.

Romain

goalign tranpose

I am not sure if this can be done with existing comamnd:

% cat in.afa
>seq1
AAAA
>seq2
CCTT
>seq3
ACGT

% goalign transpose < in.afa 

>1
ACA
>2
ACC
>3
ATG
>4
ATT

% goalgn transpose -v 

# go from transposed back to alignment

suggested enhacement: mask w.r.t. to reference

Hi,

A suggested enhancement to mask, please feel free to ignore!

One useful thing for masking sequences is to mask them with respect to positions in an un-gapped reference. E.g. imagine I had:

ref1    AAC---GGG
seq1    AACTTTGGA

I may know that I want to mask based on position 6 of the reference sequence before it was aligned. That position ends up being position 9 in this alignment. This can be a headache in large projects because I can't know in advance if the non-reference sequence will have insertions, so it's a pain to figure out by hand where the position I want to mask has ended up in the final alignment.

In this case my desired output would be:

ref1    AAC---GGN
seq1    AACTTTGGN

and I might think of a command line something like

goalign mask -ref 'ref1' -s 6 -l 1

The key difference being that if one specifies some flag like -ref [ref_seq_name] then the -s and -l flags would correspond to ungapped positions in the named reference sequence, not positions in the alignment.

Rob

goalign detecting amino acid file as nucleotide file

Thank you for developing this helpful tool.

I'm running into an issue with goalign compute where the tool is automatically detecting my file as a nucleotide file even though there are amino acid characters in it (S, Y, T). Below I include a snippet of my .faa file.

>GCA_0
SCYTGAK
>GCA_1
SAYSASK
>GCA_2
SAYSASK
>GCA_3
SAYSASK

The command I ran is: goalign compute pssm -i N85.faa > N85.count.tsv

The output of that command is this, when I would expect there to be amino acid characters.
Screenshot 2023-11-13 at 4 44 55 PM

I tried including --auto-detect, but it didn't fix my problem.

I installed goalign through conda.

Any help would be appreciated. Please let me know if I can provide any other information. Thank you!

Add options to allow partial bootstrap sampling.

Hi,

Can you add some options to allow users to do partial bootstrap sampling, say that the total length of my sequence is 10Mb, but I just want 1Mb when do bootsraping using goalign build seqboot/distboot.

Best,
Kun

Invalid assertion in dependency

I'm running into the following error in the 0.3.4 release (bioconda/bioconda-recipes#28432 ):

13:20:14 BIOCONDA INFO (OUT) pkg/mod/github.com/golang/[email protected]/gps/constraint.go:103:21: cannot use sv (type *semver.Version) as type semver.Version in field value
13:20:14 BIOCONDA INFO (OUT) pkg/mod/github.com/golang/[email protected]/gps/constraint.go:122:16: invalid type assertion: c.(semver.Version) (non-interface type *semver.Constraints on left)
13:20:14 BIOCONDA INFO (OUT) pkg/mod/github.com/golang/[email protected]/gps/constraint.go:149:4: undefined: semver.Constraint

I assume the gps dependency version could be restricted to avoid this.

nexus token not recognised

When converting the nexus example provided here below, we got this error message using the latest version of goalign::

Unknown token "" in taxlabel list

We are not sure whether this is a goalign issue or the following Nexus file format that is incorrect. However, it seems it is correct since it can be converted to fasta using squizz tool for instance or biopython

#NEXUS
[ Title fasta file]
begin taxa;
   dimensions ntax= 6;
   taxlabels
      read0
      read1
      read2
      read3
      read4
      read5
;
end;
begin characters;
   dimensions nchar= 100;
   format missing=? gap=- matchchar=. datatype=nucleotide interleave=yes;
   matrix

[!Domain=Data;]
read0 GCATGCTACCCCCGACTTCGAGGCTGGGTGGAGTTACCTTTAGGGGGGGTTGTGTGGGAGTGATAGGAGAGAGACCCAGACAGTATAGCATGTTGTTGGC
read1 AATCATCC.ATAT.C.G.TTCA.G..TTC.CGA.GTTACA..A.T.TCCGGTC.G.TACCGCTG.CCC..ACTTTATTT.TGACTC.AGT..G.CAACAG
read2 .G.A..CCA.G..ACGG..TT.ATAC.AATTTT.CTAA.GGCTATCCCTACA.AACCT.ACCGGGCAT.TA.TGTGTCAC.GT.G.TT.GACG.AAA.AG
read3 ATCCCGCT.GATG.G.C..ATT..GTCCACT....GATC..CT..A.TA..TA.GAAAGCAAG..AACTCCTTGTA..A.T.AAGATCTTA.A..GGCAT
read4 AGGGATG.A.GAT.CTCG.AGTTGAT.C.CAGAAGTG.CA.T.C..TA.AAACAAAT.TTCCCAGATT.TTGACTGATA.GTAGGACCTCA..C..GACT
read5 TG.GA.ATTTGAG.GAGC...TTAGATTAT..TGCCGTCAATCAT.A.CGCAC.GTTTTAACGCCTT.ATCTCC.GACTCTCAC.GCTA.CCCGTGA.CT
;
end;

Compressed output if input is compressed

Hello. Thank you for goalign.

It is great that goalign will take compressed input. But, I noticed that the output is not compressed. Would it be possible for the output to mirror the input compression? For instance, if the input is gzipped the output be also gzipped. Perhaps as a flag option to enable output compression, giving the user the option to compress the output if they wish.

Thanks again.

Remove list of columns and column ranges

If i have a text file of positions i want to remove from an alignment.
Like subseq but i can choose all positions (or inverse)

% cat seq.afa
>x
-ATGC
>y
TATG-
>z
ATCGG

% cat pos.txt
1
3
5

% goalign subseq --sitefile post.txt < seq.afa
>x
AG
>y
AG
>z
TG

Also would like option for the pos.txt to be relative to a specified "reference" taxon which ignores it's gaps.

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.